top of page

mmu_circAkap9_4526

Basic information of circular RNA
PanCircBase ID:

mmu_circAkap9_4526

mm39_Chr. Position ID:

chr5|4082680|4115910|+

Gene name:

Akap9

Transcript:

ENSMUST00000044492.10

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

18

Exon/intron indexes:

24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41

Exon/intron offsets:

0,2067,5848,6558,11237,12118,13217,17474,18355,18529,22480,22911,25755,27601,28457,31390,32500,33124

Genomic length:

33230

Exon/intron sizes in nt:

2,33,12,01,77,10,51,53,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,00,000

Flanking exon/introns:

chr5:4080052-4082680|chr5:4115910-4117739

Splice length:

4526

Other database IDs:

circAtlas: mmu-Akap9_0021

Human Ortholog IDs:
Mature spliced Sequence:

AATTTCTGCAGGAGACAGAAAAACTAATGAAGGAAAAGTTGGAAGTACAGTGTCAAGCTGAAAAAGTCCGTGGTGACCTTCAGAAGCAAGTGAAAGCTCTAGAAATAGATGTTGAAGAACAAGTCAGTAGGTTCATAGAACTGGAGCAAGAGAAAAACGCTGAACTCACAGATCTAAGGCAGCAAAGCCAAGCGCTGGAGAAGCAGCTGGAAAAAATGAGAAAATTTTTAGATGAGCAGGCCATCGATAGAGAGCACGAGAGAGATGTTTTTCAGCAGGAGATACAGAAGCTGGAGCATCAGCTTAAGGCTGTGCCTAGAATCCAGCCTGTGAGTGAGCACCAAGCCAGAGAGGTTGAACAGTTAACTAATCACTTGAAAGAGAAAACAGACAGGTGCAGTGAGCTGCTGCTATCCAAGGAGCAACTGCAGCGAGACATTCAGGAGAGGAATGAGGAGATTGAGAAGCTGGAGTGCCGAGTGCGAGAGCTGGAGCAAGCCCTGCTGGCTAGTGCAGAGCCCTTCCCCAAGGTAGAGGACCAGAAAAGGTCTGGAGCTGTAGAAGCAGACCCAGAATTATCCCTAGAAGTTCAGTTGCAGGTGGAGCGGGATGCTACAGACAGAAAACAGAAAGAGATCACCAACCTAGAAGAACAATTAGAACAGTTTCGGGAAGAACTGGAAAATAAGAACGATGAGGTCCAGGAGCTCCTCATGCAGCTGGAGATTCAGAGAAAAGAGTCCACCACCCGCCTGCAGGAGCTGCAGCAGGAAAACAGGCTATTTAAGGATGAAATAGAAAAACTTGGGTTTGCCATGAAGGAATCTGATTCTGTATCTACTCGGGATCAGCCCATGCTGTTTGGCAAATTTGCACAGCTAATACAAGAAAAGGAGATTGAAATTGACCGGTTAAATGAGCAGTTTATAAAACTGCAGCAGCAACTTAAACTCACAACGGATAACAAGGTCATTGAAGAACAAAAGGAACAGATACAAGATCTGGAAACCCAGATTGAACGTTTGATGAGTGAGCGAGAACATGAGAAGAAACAGAGAGAGGAAGAAGTAGAGCAGCTCACTGGGGTGGTTGAGAAACTGCAGCAGGAGGTGGTCAGCACTGAACAGCAGAGAGAGGGTGCCAGGACCCTCCCAGAAGATGAGGAGAGCTTTAAACATCAGCTGGACAAGGTGACTGCTGAAAAGCTGGTTTTAGAGCAACAAGTAGAAACCACCAACCAGGTAATGACGCACATGAACAATGTCCTTAAAGAAATCAATTTCAAAATGGATCAGATAACACAATCACTGTGCAACTTGAATAAAGAATGTGCCAGCAATGAAGAACTTCCAAGTCTACCTAAGGAAAGTGTCCACATGACTGTGCATGAGCTAGGCAGTGACAATCTGCAGCCAGAAGATGCCCCTGCCCAGGATGTGACCAAACCTCTAGAAAAACAGACCTCCCTTACGCGTCTTCAGAAAAGCCCTGAAGCTTCTAGAACACAAGAAATAGAGTCCCTGGCAAGCTCTGTTGGCGCCAAGGACGTTGAGCTTACCCAGTGTCGTGAACAAACAGAAACCATACAAGAGCAAGCCCAGTCTGAGACAGACAGGCTTCAGAAGAAGCTCACAGACCTGCAGAGAAGCCTTGAGAAGTTCGCCGCTGCACTGGTCAGTCAGGTCCAAATGGAGGCAGCTCAGGAGTATGTGCCGTTCCACCAAGAAAAGCAGCCGGTTTCATCAGCACCCGGAAGCACAGATATACAGAATGCAAATGGTCTGACTGGAGCCAGCACGGAGTCACTCATCCCCACAGTGACCCTGAGGCTAGCAGAGGTGGAGAGCCGTGTAGCTGAAGTGCACAGTGGTACAATGTCAGAAAAACTTGTGGGAATTGTGGGGGGAAATGCTTCAGAGACAGAAAAGAGAGTTATAGAGCTACAGAAGCTATTGGAGGAGGCCGAGGAAAGACCGGAAGAGGGAGGAGAACAAAGCTCTCGGGATGGGGAGGTAAGAGAAAGCTACATGACATCACTGCAGAAGGACTTAGGCCAAGTTAAAGATCCACTCACAGAAGCCAAGGAGAAACTATCCTACTCCTTAGAAAAAGAAAAGAGGACTGGAGAACAGGAAAGCAGAGAGGCCCCCATACCAGAGCCACCTTCTGTTGAAGTAGGTGGCTGCTCTGGGCTCACAGAGAGAACAGACAAGGTGAGCAGCAGCGGCAATCAGACCCTGCAGATCCTTCTTAGAGACGCAGCGATTCAGACTGACTTACAGAGTGAGAGCTCCCAAGAAGAGGTCAGAGATACCATCAATCAACTTACTAAAAAAATGGAGCACATACAAGAGCTACATGCCGCTGAGATTTTGGATATGGAATCCAGACATATTTTAGAAACTGAGTCTTTGAAGAAAGAACATTATGTTGCGATCCAGTTACTGACTAAGGAATGCGAGACCCTGAAGGAGATGACCCAGTGTCTGAGATGCAAAGAGGGATCCTCCATTCCTGAATTGGCAGATTCTGTTGCTTATCAAAGTAGAGAAGTCTATTCCAGTGATTCTGAATCAGACTGGGGTCAAAGCCAGGGATTTGATACAGCAATAGAAGGCCGAGAAGAAGGGGAAACATCAGCAGATTTATTTCCAAAGAAAATAAAGGGGTTAGTGAAGGCTGTCCACAGTGAGGGCATGCAGGTGCTCTCTCTCTCCAGTCCCCTCTGTGATGATGGAGAGGACCGTTCCATTCAGCAGCTTTCGGAATCTTGGCTGAAAGAGAGACAAGCTTACCTCAATACCATCTCATCTCTTAAAGATTTAATTTCTAAGATGCAAGTGCGAAGAGAAACTGAGGTCTATGACAGGTGTCACCTCTCAGACTGGCGAGGTGAACTTCTGCTTGCCTGTCAGCGTGTTTTCATAAAGGAACGTAGTGTTTTACTAGCTACATTCCAAACTGAGCTGACATCTCTCAGCACTAGAGATGTGGATGGATTGTTAAACTCTTTGGAACAGAGAATACAAGAGCAGGGCATTGAATATCACACAGCAATGGACTGCCTGCAGAAAGCAGATAGGAGGAGTTTACTGGCTGAAATCGAAGATCTGCGTGCTCAGATTAATGGCGGGAAAATGACTCTGGAAAGAGAACAAGGAACTGAGAAAAGCAGCCAAGAACTCCTGGACTGCAGTATGCAGCAGAAGCAGTCGCTGGAAATGCAACTGGAACTCAGCAGCCTGAGAGACAGAGCAGCCGAGCTGCAGGAACAGCTGAGTTCGGAAAAGATGGTGGTTGCGGAACTAAAAAGTGAACTTGCACAGGCAAAACTGGAATTGGGAACAACACTCAAGGCCCAGCATAAGCGCCTAAAGGAATTAGAAGCATTCAGGTCGGAAGTTAAGGAGAAGACGGATGAAATCCATTTCCTTAGTGATACATTAGCAAGGGAACAGAAGAATTCATTAGAGCTGCAGTGGGCTTTGGAAAAGGAAAAGGCCAGGTCGGGACACCACGAGGGACGGGAAAAAGAAGAACTCGAGGATCTGAAATTTTCACTTGAGGATCAGAAACGGAGAAATACACAGTTAAACCTCCTTTTGGAACAACAGAAGCAGCTACTAAATGAATCTCAGCAGAAAATAGAGTCACAGAAAATGTTGCATGATGCCCAGTTATCAGAAGAACAAGGCCGCAACTTAGGGCTTCAAGCTCTCCTGGAGTCAGAGCAAGTTAGGATTCAGGAGATGAAGAGCACACTAGACAAGGAACGGGAGCTGTATGCCCAGTTGCAGAGCCGTGAAGATGGCGGGCAGCCCCCGCCAGCCTTGCCTTCTGAGGACCTACTTAAAGAGCTACAGAAACAACTGGAGGAAAAACACAGCCGCATAGTAGAACTGTTAAGTGAAACTGAAAAATATAAACTAGATTCCTTGCAAACAAGGCAACAGATGGAAAAGGACAGGCAGGTTCATCAGAAGACACTGCAGACAGAACAGGAGGCAAACACCCAGGGCCAAAAGAAAATGCAGGAGCTGCAGTCCAAAGTGGAAGAGCTGCAGCGCCAGCTCCAGGAGAAAAGGCAGCAGGTGTACAAGCTAGACCTGGAGGGAAAGCGACTGCAAGGGCTTATGCAGGAATTCCAAAAGCAGGAGCTGGAGCCGGAGGAGAAACCGGGAAGCAGAGGCCTTGTGGATCAGAATCTGAATGAGCCAGCCACCTGGAACTTCACTGATGATCGGACTAGAAATTGGGTTCTTCAACAGAAAATGGGAGAGGCCAAAGACAGGAACTTCACAAAGTTGATTGAAATAAACGGAGGAGAACTTGACCATAATCATGACTTGGAAATGATCAGACAGACACTCCAGCATGTGGCTTCAAAACTTCAGCATGTAGCCCAGAAAGCCTGCAGCAGGCTGCAGTTTGAAACAGCCGGTGATGATGCATTTATTTGGATTCAGGAGAATATTGATGGAATTATTTTGCAACTACAGAAACTAACTGGCCAGCCAGGTGATGAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GAAACAGCCGGTGATGATGC

59.9

CTGAAGGTCACCACGGACTT

59.61

179

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GAAACAGCCGGTGATGATGC

59.9

TCTGAAGGTCACCACGGACT

60.47

180

PCR template sequence:

GTTTGAAACAGCCGGTGATGATGCATTTATTTGGATTCAGGAGAATATTGATGGAATTATTTTGCAACTACAGAAACTAACTGGCCAGCCAGGTGATGAGAATTTCTGCAGGAGACAGAAAAACTAATGAAGGAAAAGTTGGAAGTACAGTGTCAAGCTGAAAAAGTCCGTGGTGACCTTCAGAAGCAAGTGAAAGCTCT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

24

Interacting miRNAs (#binding sites)

mmu-miR-136-5p(2), mmu-miR-207(2), mmu-miR-15a-5p(1), mmu-miR-206-3p(1), mmu-miR-19b-3p(1), mmu-miR-205-5p(1), mmu-miR-322-5p(1), mmu-miR-15b-5p(1), mmu-miR-19a-3p(1), mmu-miR-152-3p(1), mmu-miR-148b-3p(1), mmu-miR-148a-3p(1), mmu-miR-216a-5p(1), mmu-miR-320-3p(1), mmu-miR-25-3p(1), mmu-miR-185-5p(1), mmu-miR-149-5p(1), mmu-miR-297a-5p(1), mmu-miR-680(1), mmu-miR-29b-2-5p(1), mmu-miR-669d-5p(1), mmu-miR-3470b(1), mmu-miR-697(1), mmu-miR-1904(1)

siRNAs for circular RNA silencing
Junction sequence

GCCAGGTGATGAGAATTTCTGCAGGA

siRNA sets

GAAATTCTCATCACCTGGC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCAKAP9_4526_ORF_1

1.1719

0.26252879

1

4527

ORF sequence:

ATGAAGGAAAAGTTGGAAGTACAGTGTCAAGCTGAAAAAGTCCGTGGTGACCTTCAGAAGCAAGTGAAAGCTCTAGAAATAGATGTTGAAGAACAAGTCAGTAGGTTCATAGAACTGGAGCAAGAGAAAAACGCTGAACTCACAGATCTAAGGCAGCAAAGCCAAGCGCTGGAGAAGCAGCTGGAAAAAATGAGAAAATTTTTAGATGAGCAGGCCATCGATAGAGAGCACGAGAGAGATGTTTTTCAGCAGGAGATACAGAAGCTGGAGCATCAGCTTAAGGCTGTGCCTAGAATCCAGCCTGTGAGTGAGCACCAAGCCAGAGAGGTTGAACAGTTAACTAATCACTTGAAAGAGAAAACAGACAGGTGCAGTGAGCTGCTGCTATCCAAGGAGCAACTGCAGCGAGACATTCAGGAGAGGAATGAGGAGATTGAGAAGCTGGAGTGCCGAGTGCGAGAGCTGGAGCAAGCCCTGCTGGCTAGTGCAGAGCCCTTCCCCAAGGTAGAGGACCAGAAAAGGTCTGGAGCTGTAGAAGCAGACCCAGAATTATCCCTAGAAGTTCAGTTGCAGGTGGAGCGGGATGCTACAGACAGAAAACAGAAAGAGATCACCAACCTAGAAGAACAATTAGAACAGTTTCGGGAAGAACTGGAAAATAAGAACGATGAGGTCCAGGAGCTCCTCATGCAGCTGGAGATTCAGAGAAAAGAGTCCACCACCCGCCTGCAGGAGCTGCAGCAGGAAAACAGGCTATTTAAGGATGAAATAGAAAAACTTGGGTTTGCCATGAAGGAATCTGATTCTGTATCTACTCGGGATCAGCCCATGCTGTTTGGCAAATTTGCACAGCTAATACAAGAAAAGGAGATTGAAATTGACCGGTTAAATGAGCAGTTTATAAAACTGCAGCAGCAACTTAAACTCACAACGGATAACAAGGTCATTGAAGAACAAAAGGAACAGATACAAGATCTGGAAACCCAGATTGAACGTTTGATGAGTGAGCGAGAACATGAGAAGAAACAGAGAGAGGAAGAAGTAGAGCAGCTCACTGGGGTGGTTGAGAAACTGCAGCAGGAGGTGGTCAGCACTGAACAGCAGAGAGAGGGTGCCAGGACCCTCCCAGAAGATGAGGAGAGCTTTAAACATCAGCTGGACAAGGTGACTGCTGAAAAGCTGGTTTTAGAGCAACAAGTAGAAACCACCAACCAGGTAATGACGCACATGAACAATGTCCTTAAAGAAATCAATTTCAAAATGGATCAGATAACACAATCACTGTGCAACTTGAATAAAGAATGTGCCAGCAATGAAGAACTTCCAAGTCTACCTAAGGAAAGTGTCCACATGACTGTGCATGAGCTAGGCAGTGACAATCTGCAGCCAGAAGATGCCCCTGCCCAGGATGTGACCAAACCTCTAGAAAAACAGACCTCCCTTACGCGTCTTCAGAAAAGCCCTGAAGCTTCTAGAACACAAGAAATAGAGTCCCTGGCAAGCTCTGTTGGCGCCAAGGACGTTGAGCTTACCCAGTGTCGTGAACAAACAGAAACCATACAAGAGCAAGCCCAGTCTGAGACAGACAGGCTTCAGAAGAAGCTCACAGACCTGCAGAGAAGCCTTGAGAAGTTCGCCGCTGCACTGGTCAGTCAGGTCCAAATGGAGGCAGCTCAGGAGTATGTGCCGTTCCACCAAGAAAAGCAGCCGGTTTCATCAGCACCCGGAAGCACAGATATACAGAATGCAAATGGTCTGACTGGAGCCAGCACGGAGTCACTCATCCCCACAGTGACCCTGAGGCTAGCAGAGGTGGAGAGCCGTGTAGCTGAAGTGCACAGTGGTACAATGTCAGAAAAACTTGTGGGAATTGTGGGGGGAAATGCTTCAGAGACAGAAAAGAGAGTTATAGAGCTACAGAAGCTATTGGAGGAGGCCGAGGAAAGACCGGAAGAGGGAGGAGAACAAAGCTCTCGGGATGGGGAGGTAAGAGAAAGCTACATGACATCACTGCAGAAGGACTTAGGCCAAGTTAAAGATCCACTCACAGAAGCCAAGGAGAAACTATCCTACTCCTTAGAAAAAGAAAAGAGGACTGGAGAACAGGAAAGCAGAGAGGCCCCCATACCAGAGCCACCTTCTGTTGAAGTAGGTGGCTGCTCTGGGCTCACAGAGAGAACAGACAAGGTGAGCAGCAGCGGCAATCAGACCCTGCAGATCCTTCTTAGAGACGCAGCGATTCAGACTGACTTACAGAGTGAGAGCTCCCAAGAAGAGGTCAGAGATACCATCAATCAACTTACTAAAAAAATGGAGCACATACAAGAGCTACATGCCGCTGAGATTTTGGATATGGAATCCAGACATATTTTAGAAACTGAGTCTTTGAAGAAAGAACATTATGTTGCGATCCAGTTACTGACTAAGGAATGCGAGACCCTGAAGGAGATGACCCAGTGTCTGAGATGCAAAGAGGGATCCTCCATTCCTGAATTGGCAGATTCTGTTGCTTATCAAAGTAGAGAAGTCTATTCCAGTGATTCTGAATCAGACTGGGGTCAAAGCCAGGGATTTGATACAGCAATAGAAGGCCGAGAAGAAGGGGAAACATCAGCAGATTTATTTCCAAAGAAAATAAAGGGGTTAGTGAAGGCTGTCCACAGTGAGGGCATGCAGGTGCTCTCTCTCTCCAGTCCCCTCTGTGATGATGGAGAGGACCGTTCCATTCAGCAGCTTTCGGAATCTTGGCTGAAAGAGAGACAAGCTTACCTCAATACCATCTCATCTCTTAAAGATTTAATTTCTAAGATGCAAGTGCGAAGAGAAACTGAGGTCTATGACAGGTGTCACCTCTCAGACTGGCGAGGTGAACTTCTGCTTGCCTGTCAGCGTGTTTTCATAAAGGAACGTAGTGTTTTACTAGCTACATTCCAAACTGAGCTGACATCTCTCAGCACTAGAGATGTGGATGGATTGTTAAACTCTTTGGAACAGAGAATACAAGAGCAGGGCATTGAATATCACACAGCAATGGACTGCCTGCAGAAAGCAGATAGGAGGAGTTTACTGGCTGAAATCGAAGATCTGCGTGCTCAGATTAATGGCGGGAAAATGACTCTGGAAAGAGAACAAGGAACTGAGAAAAGCAGCCAAGAACTCCTGGACTGCAGTATGCAGCAGAAGCAGTCGCTGGAAATGCAACTGGAACTCAGCAGCCTGAGAGACAGAGCAGCCGAGCTGCAGGAACAGCTGAGTTCGGAAAAGATGGTGGTTGCGGAACTAAAAAGTGAACTTGCACAGGCAAAACTGGAATTGGGAACAACACTCAAGGCCCAGCATAAGCGCCTAAAGGAATTAGAAGCATTCAGGTCGGAAGTTAAGGAGAAGACGGATGAAATCCATTTCCTTAGTGATACATTAGCAAGGGAACAGAAGAATTCATTAGAGCTGCAGTGGGCTTTGGAAAAGGAAAAGGCCAGGTCGGGACACCACGAGGGACGGGAAAAAGAAGAACTCGAGGATCTGAAATTTTCACTTGAGGATCAGAAACGGAGAAATACACAGTTAAACCTCCTTTTGGAACAACAGAAGCAGCTACTAAATGAATCTCAGCAGAAAATAGAGTCACAGAAAATGTTGCATGATGCCCAGTTATCAGAAGAACAAGGCCGCAACTTAGGGCTTCAAGCTCTCCTGGAGTCAGAGCAAGTTAGGATTCAGGAGATGAAGAGCACACTAGACAAGGAACGGGAGCTGTATGCCCAGTTGCAGAGCCGTGAAGATGGCGGGCAGCCCCCGCCAGCCTTGCCTTCTGAGGACCTACTTAAAGAGCTACAGAAACAACTGGAGGAAAAACACAGCCGCATAGTAGAACTGTTAAGTGAAACTGAAAAATATAAACTAGATTCCTTGCAAACAAGGCAACAGATGGAAAAGGACAGGCAGGTTCATCAGAAGACACTGCAGACAGAACAGGAGGCAAACACCCAGGGCCAAAAGAAAATGCAGGAGCTGCAGTCCAAAGTGGAAGAGCTGCAGCGCCAGCTCCAGGAGAAAAGGCAGCAGGTGTACAAGCTAGACCTGGAGGGAAAGCGACTGCAAGGGCTTATGCAGGAATTCCAAAAGCAGGAGCTGGAGCCGGAGGAGAAACCGGGAAGCAGAGGCCTTGTGGATCAGAATCTGAATGAGCCAGCCACCTGGAACTTCACTGATGATCGGACTAGAAATTGGGTTCTTCAACAGAAAATGGGAGAGGCCAAAGACAGGAACTTCACAAAGTTGATTGAAATAAACGGAGGAGAACTTGACCATAATCATGACTTGGAAATGATCAGACAGACACTCCAGCATGTGGCTTCAAAACTTCAGCATGTAGCCCAGAAAGCCTGCAGCAGGCTGCAGTTTGAAACAGCCGGTGATGATGCATTTATTTGGATTCAGGAGAATATTGATGGAATTATTTTGCAACTACAGAAACTAACTGGCCAGCCAGGTGATGAGAATTTCTGCAGGAGACAGAAAAACTAA

Peptide sequence:

MKEKLEVQCQAEKVRGDLQKQVKALEIDVEEQVSRFIELEQEKNAELTDLRQQSQALEKQLEKMRKFLDEQAIDREHERDVFQQEIQKLEHQLKAVPRIQPVSEHQAREVEQLTNHLKEKTDRCSELLLSKEQLQRDIQERNEEIEKLECRVRELEQALLASAEPFPKVEDQKRSGAVEADPELSLEVQLQVERDATDRKQKEITNLEEQLEQFREELENKNDEVQELLMQLEIQRKESTTRLQELQQENRLFKDEIEKLGFAMKESDSVSTRDQPMLFGKFAQLIQEKEIEIDRLNEQFIKLQQQLKLTTDNKVIEEQKEQIQDLETQIERLMSEREHEKKQREEEVEQLTGVVEKLQQEVVSTEQQREGARTLPEDEESFKHQLDKVTAEKLVLEQQVETTNQVMTHMNNVLKEINFKMDQITQSLCNLNKECASNEELPSLPKESVHMTVHELGSDNLQPEDAPAQDVTKPLEKQTSLTRLQKSPEASRTQEIESLASSVGAKDVELTQCREQTETIQEQAQSETDRLQKKLTDLQRSLEKFAAALVSQVQMEAAQEYVPFHQEKQPVSSAPGSTDIQNANGLTGASTESLIPTVTLRLAEVESRVAEVHSGTMSEKLVGIVGGNASETEKRVIELQKLLEEAEERPEEGGEQSSRDGEVRESYMTSLQKDLGQVKDPLTEAKEKLSYSLEKEKRTGEQESREAPIPEPPSVEVGGCSGLTERTDKVSSSGNQTLQILLRDAAIQTDLQSESSQEEVRDTINQLTKKMEHIQELHAAEILDMESRHILETESLKKEHYVAIQLLTKECETLKEMTQCLRCKEGSSIPELADSVAYQSREVYSSDSESDWGQSQGFDTAIEGREEGETSADLFPKKIKGLVKAVHSEGMQVLSLSSPLCDDGEDRSIQQLSESWLKERQAYLNTISSLKDLISKMQVRRETEVYDRCHLSDWRGELLLACQRVFIKERSVLLATFQTELTSLSTRDVDGLLNSLEQRIQEQGIEYHTAMDCLQKADRRSLLAEIEDLRAQINGGKMTLEREQGTEKSSQELLDCSMQQKQSLEMQLELSSLRDRAAELQEQLSSEKMVVAELKSELAQAKLELGTTLKAQHKRLKELEAFRSEVKEKTDEIHFLSDTLAREQKNSLELQWALEKEKARSGHHEGREKEELEDLKFSLEDQKRRNTQLNLLLEQQKQLLNESQQKIESQKMLHDAQLSEEQGRNLGLQALLESEQVRIQEMKSTLDKERELYAQLQSREDGGQPPPALPSEDLLKELQKQLEEKHSRIVELLSETEKYKLDSLQTRQQMEKDRQVHQKTLQTEQEANTQGQKKMQELQSKVEELQRQLQEKRQQVYKLDLEGKRLQGLMQEFQKQELEPEEKPGSRGLVDQNLNEPATWNFTDDRTRNWVLQQKMGEAKDRNFTKLIEINGGELDHNHDLEMIRQTLQHVASKLQHVAQKACSRLQFETAGDDAFIWIQENIDGIILQLQKLTGQPGDENFCRRQKN

IRESfinder result

IRESfinder score

0.479977139

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page