top of page

mmu_circAkap6_3388

Basic information of circular RNA
PanCircBase ID:

mmu_circAkap6_3388

mm39_Chr. Position ID:

chr12|53186163|53189551|+

Gene name:

Akap6

Transcript:

ENSMUST00000095737.5

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

1

Exon/intron indexes:

13

Exon/intron offsets:

0

Genomic length:

3388

Exon/intron sizes in nt:

3388

Flanking exon/introns:

chr12:53151513-53186163|chr12:53189551-53194593

Splice length:

3388

Other database IDs:

circBase: mmu_circ_0000379, CIRCpedia: MMU_CIRCpedia_22533, circAtlas: mmu-Akap6_0008

circBase: hsa_circ_0101667, circAtlas: hsa-AKAP6_0008, CIRCpedia: HSA_CIRCpedia_11990

Human Ortholog IDs:
Mature spliced Sequence:

GAGACTCTGAATGTGATTGACCCTGGCTTGATGGACCTGAATGGAATGAGTGAGGATGCCCTGGAATGGGATGAGACAGACATAAGTAACAAACTCATTAGTGTGCATGAAGAATCCAACGACCTTGATCAAGACCTGGAGCCTATGGTCCCAACAGTGAAACTTGAAGAGACACACCACAAGGACTCCGGTTATGAAGAGGAGGCAGGTGACTGTGGAGGGTCCCAGTATACCTCAAATATCACTGCCCCTTCCAGCCCACACATTTACCAAGTGTACAGTCTCCACAATGTTGAGTTCCACGAGGACAGCCACACTCAGTTTCTAAAAAGCAGCCCCAAGTTCACAGGCACAGTGCAGCCCACTGTTTTAACTAAGAGCCTCAGTAAAGATTCTTCATTTTCATCCACAAAATCGTTACCAGACCTTTTAGGGGGTTCCAGCTTGGTGAGGCCTTACTCGTGTCAGAGTGGAGACTTGAGCCAGAATTCAGGCAGTGAGAGTGGAATTGTCAGCGAAGGAGACAATGAGATGCCAACCAACTCCGACATGAGCTTGTTCAGTATGGTCGATGGGTCCCCGAGTAACCCTGAAACACAACATCTGGACCCACAAATGGGAGACGCAGCCAATGTGCTGGAGCAAAAATTTAAAGATGAGGGGGAGTGCATTAAGCTTTCAAGTGTCTCTCAGGCATCTGTCTCACCAGTGGGTTGTGTAAATGGGAAAGCTGGGGACTTAAACAGTATTACCAAACACACCACTGATTGTTTGGGAGACGAATTACAAGGAAAACATGAGGTGTTTACATTTTATGACTACTCGTACCTCCAAGGCTCAAAACTCAAATTCCCAATGATAATGAAACAGCCGCAGAGTGAGAAGGCACATTTGGAGGATCCCCTTCTTCGTGGTTTCTATTTTGATAAAAAGTCCTGCAAACCTAAACATCAGACTTCTGAGTCACAACCAGACGCGCCCCTCCATGAAAAGATCTTGGCAAGTGCCCCCCACGAGATGGGTCGAAGCTCATACAAAAGTAGCGACATAGAGAAGGCACTCACGGGCATCCAGAATGCCCGACAGCTCTCCCTTTTATCTCGTAGCTCATCTGTAGAGTCCCTTTCCCCAGGGGGTGATTTGTTTGGATTGGGAATCTTTAAAAATGGCAGTGACAGCCTCCAGCGAAGCACTTCTTTAGAAAGTTGGTTGACATCCTATAAGAGCAACGAGGATCTTTTTAGCTGTCACAGCTCTGGGGACATAAGTGTGAGCAGTGGCTCGGTTGGTGAGCTGAGCAAGAGGACATTAGATCTTTTGAATCGTCTGGAGAACATACAGAGCCCCTCAGAGCAAAAGATCAAGCGGAGTGTTTCAGATATCACTCTGCAAAGCAGTTCCCAAAAGATGTCCTTCAGTGGCCAGATGTCACTGGATGTCGCATCCTCTATCAATGAAGACTCGCCGGCATCTCTTACCGAACTGAGTAGCAGCGATGAGCTCTCTCTTTGCTCGGAGGACATTGTGTTACACAAAAACAAGGTCCCAGAGTCCAACGCATCATTCAGGAAGCGCCTGAATCGCTCGGTGGCTGATGAGAGCGACGTCAATGTCAGCATGATTGTCAACGTCTCCTGCACCTCTGCTTGCACTGATGACGAAGACGACAGCGACCTCCTCTCCAGCTCCACTCTCACCTTGACGGAAGAAGAGCTGTGTCTCAAAGATGAGGATGACGACTCCAGTATCGCAACGGATGATGAAATTTATGAGGAAAGCAACCTGATGTCTGGGCTGGACTACATCAAGAACGAACTGCAGACGTGGATAAGACCCAAACTTTCCTTGTCGAGAGAAAAGAAACGGCCCAGTGTCACTGATGAAATAAAGGTCAATAAAGATGGAGGAAGTACCGAGAGGGCCAATCCCTCGGACACCCTGGACATTGAGGCCCTTCTAAATTGCTCCATAAAACGTCTCTCTGAAAACAATGGGAATGGCAAGAACCCACCCAGAACTCATGACTTAGGAACCAAAGGTGAAAATAAGAAAAATACGTACGACGTTACTAAAGATCCACATGTGGCCGACATGGAAAATGGCAATGTTGAAAGTACTCCAGAGAGAGAAAAGGAGAAGCCAGAGATCCCAGAGGCATCAGCGAACCTTGCTTCAAATGTGAAAAAGATTTCTGAATCCAAGCACGACGAGTATGAAGCATTAATGGATGGTTCTGATGATTCAAGTGTCACTGGGAAGGAATTTGGTCCCCCAAATGATAGGCATCCTCCACAGATTGGTGCCGATCCCCAGCATCCTGAAAGGGGTGACTGCACATCAGTCCAGAACTCTTGCTCAGGACTACTGTTGGAAACCGGTGGCGGAAGCAGACAAGATAGTGATGGACTCAAATCTTTGTCTAATGATGCACCAAGTGTGGCTAGAAACGCTGCTGGTTGCTGCCTACTCGAACAAAATGAGACAGAGGAAAGTGCTTCTATCAGCAGCAGCACTTCCTGTTGCAACTGCAAGCCAGATGTTTTCCATCAGAAAGATGATGAAGATTGTTCGGTACATGACTTTGTTAAGGAAATCATTGACATGGCATCAACAGCCCTCAAAAGTAAATCACAACCTGAGAGTGAGGTGGCCGCTCCCACGTCACTGACCCAAATTAAGGAGAAAGTGTTAGAGCATTCGCATCGGCCCATACACCTGAGGAAGGGAGATTTTTACTCCTACCTATCTCTTTCGTCCCATGACAGTGACTGTGGGGAGGTCACCAATTACATAGATGAGAAGAGCAACACCCCATTGCCACCAGACACCGTGGACTCTGGCTTAGATGACAAGGAAGACGTGGACTGCTTCTTTGAAGCTTGTGTTGAGGACGAGCCTGCTGATGAGGAAGCCCGTCTCTCCAGTGCCCTTCCAAATGAATCAGAAGTCCAGGATGAAGCTGCTAAGCCAGAACAAATGACAGCCAGCTCTTCTGTGTTCCGTGATGAGACAGACACGGTGCCTCTTTCAGGACTTTCCCCTCAGAAGGGAGCTGATGATGCAAAGGAAGGAGATGGTGCGTCCCACACTTCCCAGGGCTGTGTGGAGAGCGCAGAGCCTACCACCCCCCCAGGAAAGGCCAAGAGAGAGGGGAGTTCAAGAAAGCAAAGTGTATCAGGAACGCCAGAAGAAAACGCTGCTTCAGCCAAACCGAAAATTCAAGCTTTCTCTTTGAATGCAAAACAGCCAAAAGGCAAGGCTGCACTGTATCCCAGCCCCCAAACTTTAACCTGCAAAGAGAAGCTCGTAAGCTTTCATGAAGATCGACATAGTAACATGCATAGGTAGAATGTAATGCCCCCAAGCATGGAACTCATCTCATTGAAAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

ACCTGCAAAGAGAAGCTCGT

59.61

TCCAGGGCATCCTCACTCAT

60.33

165

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

ACCTGCAAAGAGAAGCTCGT

59.61

TTCAGGTCCATCAAGCCAGG

59.67

141

PCR template sequence:

ACCTGCAAAGAGAAGCTCGTAAGCTTTCATGAAGATCGACATAGTAACATGCATAGGTAGAATGTAATGCCCCCAAGCATGGAACTCATCTCATTGAAAGGAGACTCTGAATGTGATTGACCCTGGCTTGATGGACCTGAATGGAATGAGTGAGGATGCCCTGGAATGGGATGAGACAGACATAAGTAACAAACTCATTA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

23

Interacting miRNAs (#binding sites)

mmu-miR-9-5p(1), mmu-miR-23b-3p(1), mmu-miR-34c-5p(1), mmu-miR-30a-5p(1), mmu-miR-152-3p(1), mmu-miR-30c-5p(1), mmu-miR-328-3p(1), mmu-miR-326-3p(1), mmu-miR-23a-3p(1), mmu-miR-185-5p(1), mmu-miR-139-5p(1), mmu-miR-149-5p(1), mmu-miR-29b-1-5p(1), mmu-miR-199b-3p(1), mmu-miR-199a-3p(1), mmu-miR-34b-5p(1), mmu-miR-207(1), mmu-miR-335-3p(1), mmu-miR-484(1), mmu-miR-3470b(1), mmu-miR-574-5p(1), mmu-miR-7a-1-3p(1), mmu-miR-542-5p(1)

siRNAs for circular RNA silencing
Junction sequence

ATCTCATTGAAAGGAGACTCTGAATG

siRNA sets

ATTCAGAGTCTCCTTTCAA, CATTCAGAGTCTCCTTTCA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.491788536

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page