top of page

mmu_circAgtpbp1_3042

Basic information of circular RNA
PanCircBase ID:

mmu_circAgtpbp1_3042

mm39_Chr. Position ID:

chr13|59621501|59692265|-

Gene name:

Agtpbp1

Transcript:

ENSMUST00000022040.14

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

21

Exon/intron indexes:

22,21,20,19,18,17,16,15,14,13,12,11,10,9,8,7,6,5,4,3,2

Exon/intron offsets:

0,844,1972,3306,8829,21645,21875,23288,26326,30506,34271,38636,40399,43965,51458,54699,57369,58325,59484,62561,70699

Genomic length:

70764

Exon/intron sizes in nt:

130,181,154,145,88,149,87,84,689,117,98,178,209,38,94,132,147,64,68,125,65

Flanking exon/introns:

chr13:59613930-59621501|chr13:59692265-59705036

Splice length:

3042

Other database IDs:

circBase: mmu_circ_0004711, CIRCpedia: MMU_CIRCpedia_24520, circAtlas: mmu-Agtpbp1_0061

circAtlas: hsa-AGTPBP1_0173

Human Ortholog IDs:
Mature spliced Sequence:

ATTATCTGCAATGCTGGAATGAAGTAACTCAAGATGAGCAAGCTAAAAGTGGTGGGAGAGAAAAGCCTTACCAATAGTTCTCGGGTTGTGGGACTCCTGGCTCAGCTGGAGAAGATCAATACGGATTCCACAGAGTCAGATACTGCCAGATATGTTACATCCAAAATTCTTCATTTGGCTCAAAGTCAAGAAAAAACAAGAAGGGAAATGACAACCAAAGGTTCTACAGGCATGGAAGTTCTGTTGTCAACATTGGAGAACACGAAAGATCTTCAGACTGTACTTAATATCCTAAGCATTCTCATTGAGCTGGTGTCATCGGGTGGGGGTCGAAGAGCGAGTTTCTTAGTTGCCAAAGGTGGTTCACAAATACTGTTGCAACTGCTTATGAATGCCAGCAAAGACTCTCCTCCACATGAGGAGGTGATGGTGCAGACTCACTCCATTCTTGCCAAGATTGGGCCAAAAGATAAGAAATTTGGAGTGAAAGCTCGAGTTAACGGGGCACTGACTGTGACTCTGAACTTGGTAAAGCAGCACTTTCAGAACTACCGCTTGGTTCTTCCTTGTCTTCAGCTCTTGCGAGTCTATTCTACCAACTCTGTGAACTCAGTATCTTTAGGTAAAAATGGAGTTGTGGAGTTGATGTTTAAAATCATTGGGCCATTCAGTAAGAAGAATTCGGGTCTCATGAAGGTTGCTTTAGACACTCTTGCTGCATTGCTAAAATCAAAGACAAACGCCAGGAGAGCGGTGGACAGAGGGTACGTTCAAGTGCTTCTAACCATCTATGTAGATTGGCACCGGCATGATAATCGGCATAGAAACATGCTCATTCGGAAGGGGATTCTACAGAGCTTAAAAAGTGTCACGAACATCAAGTTGGGCAGAAAAGCATTTATTGATGCGAATGGGATGAAAATTCTGTATAACACTTCTCAAGAGTGCTTGGCGGTCAGGACTCTTGATCCTCTTGTCAACACATCCAGTCTGATAATGAGAAAATGCTTCCCCAAAAACCGCCTTCCGCTCCCCACCATTAAAAGTTCTTTCCACTTCCAATTGCCAATTATCCCTGTGACTGGACCTGTGGCCCAGCTCTACAGCTTGCCGCCTGAAGTGGACGATGTGGTGGACGAGAGTGACGACAACGACGACATTGATTTAGAAGTGGAAAATGAACTCGAGAATGAAGATGACCTAGATCAGAGTTTTAAGAATGATGATATTGAAACAGATATTAATAAATTAAGACCTCAGCAAGTACCAGGACGAACAATAGAAGAACTAAAAATGTACGAGCACCTTTTCCCCGAGCTTGTTGATGATTTTCAGGACTATGAACTGATCTCTAAGGAACCCAAACCTTTTGTGTTTGAGGGGAAGGCTCGGGGCCCCATTGTAGTTCCCACAGCTGGAGAGGAGGTACCTGGGAATTCAGGGAGCGTAAAGAAAGGAGTGGTAATGAAGGAGAGAGCAAGTCCTAAAGGAGAGGAAGCCAAGGAAGACCCTAAGGGCCACGACAGGACACTGCCGCAGCAGCTGGGTGGCCAGAGCAGAGTGGCCCCCTCAGCCCACAGCTTCAACAATGATCTTGTGAAGGCCCTAGACCGAATCACACTGCAGAATGTTCCTTCGCAAGTAGCCTCGGGCTTGAACGCAGGAATGAGGAAGGACTTTGGTCTCCCTCTCACTGTCCTCTCATGCACGAAAGCTTGTCCTCACGTGGCTAAGTGTGGAAGTACTCTCTTTGAAGGGCGGACGGTACATCTTGGGAAGCTGTGTTGTACTGGAGTTGAAACGGAAGATGACGAAGACACTGAGTCCCACTCATCAACAGAGCAGGCCCCCTCTGTTGAAGCCTCTGATGGACCAACACTGCACGACCCAGACCTCTATATTGAGATTGTGAAAAATACGAAGTCCGTTCCAGAATACTCAGAGGTGGCTTATCCTGATTATTTTGGTCACATTCCACCTCCCTTCAAAGAGCCTATTTTAGAAAGGCCTTATGGTGTACAAAGGACAAAAATTGCCCAAGACATCGAGAGGCTGATACACCAGAACGATATCATAGACCGCGTGGTGTATGACTTAGACAACCCTACCTATACCACTCCAGAAGAAGGAGATACTTTGAAGTTTAACTCAAAATTCGAATCTGGGAATCTGCGCAAAGTAATTCAAATTAGAAAAAGCGAGTACGACCTTATCCTGAACTCTGATATAAACAGTAACCATTACCACCAGTGGTTCTACTTTGAAGTCAGTGGGATGCGGCCTGGTGTGGCATATAGGTTCAACATCATCAACTGTGAGAAGTCCAACAGTCAGTTTAATTATGGTATGCAGCCACTTATGTATTCAGTTCAGGAAGCACTAAATGCCAGACCATGGTGGATCCGTATGGGCACTGACATTTGTTACTACAAAAATCACTTCTCACGAAGCTCAGTTGCCGCAGGCGGACAGAAGGGCAAGTCCTACTACACCATCACCTTCACCGTGAACTTCCCGCACAAGGACGATGTCTGCTATTTCGCCTATCACTATCCATACACGTACTCGACTCTGCAGATGCATCTTCAAAAATTGGAATCGGCACACAATCCTCAACAAATCTATTTTCGAAAAGACGTGTTGTGTGAAACCTTGTCTGGAAACATCTGTCCTTTGGTGACCATAACAGCAATGCCAGAGTCCAATTACTATGAACATATCTGTCAGTTCAGAACTCGCCCTTATATTTTCTTGTCTGCTCGGGTCCATCCTGGAGAAACCAATGCAAGCTGGGTAATGAAAGGAACACTGGAGTACCTCATGAGCAATAGCCCGACTGCCCAGAGCCTACGGGAGTCTTACATTTTTAAAATTGTCCCCATGCTAAATCCAGATGGTGTCATCAATGGAAATCACCGCTGCTCCTTAAGTGGAGAGGATTTGAACAGACAGTGGCAAAGTCCAAACCCAGAGTTACACCCCACGATTTATCATGCCAAGGGGCTGCTGCAGTACCTGGCCGCGGTGAAGCGCCTACCTCTG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

AGTGGCAAAGTCCAAACCCA

60.03

GGCTTTTCTCTCCCACCACT

59.6

159

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

AGTGGCAAAGTCCAAACCCA

60.03

AGGCTTTTCTCTCCCACCAC

59.6

160

PCR template sequence:

GAACAGACAGTGGCAAAGTCCAAACCCAGAGTTACACCCCACGATTTATCATGCCAAGGGGCTGCTGCAGTACCTGGCCGCGGTGAAGCGCCTACCTCTGATTATCTGCAATGCTGGAATGAAGTAACTCAAGATGAGCAAGCTAAAAGTGGTGGGAGAGAAAAGCCTTACCAATAGTTCTCGGGTTGTGGGACTCCTGG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

33

Interacting miRNAs (#binding sites)

mmu-miR-182-5p(3), mmu-miR-205-5p(2), mmu-miR-137-3p(1), mmu-miR-9-5p(1), mmu-miR-20b-5p(1), mmu-miR-27b-3p(1), mmu-miR-27a-3p(1), mmu-miR-106a-5p(1), mmu-miR-93-5p(1), mmu-miR-20a-5p(1), mmu-miR-17-5p(1), mmu-miR-1a-3p(1), mmu-miR-199a-5p(1), mmu-miR-375-3p(1), mmu-let-7e-5p(1), mmu-miR-34a-5p(1), mmu-miR-106b-5p(1), mmu-miR-335-5p(1), mmu-miR-18a-5p(1), mmu-miR-328-3p(1), mmu-miR-298-5p(1), mmu-miR-320-3p(1), mmu-let-7d-5p(1), mmu-miR-136-5p(1), mmu-miR-127-3p(1), mmu-miR-676-3p(1), mmu-miR-127-5p(1), mmu-miR-425-5p(1), mmu-miR-29b-2-5p(1), mmu-miR-377-3p(1), mmu-miR-190b-5p(1), mmu-miR-670-5p(1), mmu-miR-7a-1-3p(1)

siRNAs for circular RNA silencing
Junction sequence

GCGCCTACCTCTGATTATCTGCAATG

siRNA sets

GATAATCAGAGGTAGGCGC, AGATAATCAGAGGTAGGCG, ATTGCAGATAATCAGAGGT

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCAGTPBP1_3042_ORF_1

1.0165

0.195498503

0.999999995

3036

ORF sequence:

ATGAGCAAGCTAAAAGTGGTGGGAGAGAAAAGCCTTACCAATAGTTCTCGGGTTGTGGGACTCCTGGCTCAGCTGGAGAAGATCAATACGGATTCCACAGAGTCAGATACTGCCAGATATGTTACATCCAAAATTCTTCATTTGGCTCAAAGTCAAGAAAAAACAAGAAGGGAAATGACAACCAAAGGTTCTACAGGCATGGAAGTTCTGTTGTCAACATTGGAGAACACGAAAGATCTTCAGACTGTACTTAATATCCTAAGCATTCTCATTGAGCTGGTGTCATCGGGTGGGGGTCGAAGAGCGAGTTTCTTAGTTGCCAAAGGTGGTTCACAAATACTGTTGCAACTGCTTATGAATGCCAGCAAAGACTCTCCTCCACATGAGGAGGTGATGGTGCAGACTCACTCCATTCTTGCCAAGATTGGGCCAAAAGATAAGAAATTTGGAGTGAAAGCTCGAGTTAACGGGGCACTGACTGTGACTCTGAACTTGGTAAAGCAGCACTTTCAGAACTACCGCTTGGTTCTTCCTTGTCTTCAGCTCTTGCGAGTCTATTCTACCAACTCTGTGAACTCAGTATCTTTAGGTAAAAATGGAGTTGTGGAGTTGATGTTTAAAATCATTGGGCCATTCAGTAAGAAGAATTCGGGTCTCATGAAGGTTGCTTTAGACACTCTTGCTGCATTGCTAAAATCAAAGACAAACGCCAGGAGAGCGGTGGACAGAGGGTACGTTCAAGTGCTTCTAACCATCTATGTAGATTGGCACCGGCATGATAATCGGCATAGAAACATGCTCATTCGGAAGGGGATTCTACAGAGCTTAAAAAGTGTCACGAACATCAAGTTGGGCAGAAAAGCATTTATTGATGCGAATGGGATGAAAATTCTGTATAACACTTCTCAAGAGTGCTTGGCGGTCAGGACTCTTGATCCTCTTGTCAACACATCCAGTCTGATAATGAGAAAATGCTTCCCCAAAAACCGCCTTCCGCTCCCCACCATTAAAAGTTCTTTCCACTTCCAATTGCCAATTATCCCTGTGACTGGACCTGTGGCCCAGCTCTACAGCTTGCCGCCTGAAGTGGACGATGTGGTGGACGAGAGTGACGACAACGACGACATTGATTTAGAAGTGGAAAATGAACTCGAGAATGAAGATGACCTAGATCAGAGTTTTAAGAATGATGATATTGAAACAGATATTAATAAATTAAGACCTCAGCAAGTACCAGGACGAACAATAGAAGAACTAAAAATGTACGAGCACCTTTTCCCCGAGCTTGTTGATGATTTTCAGGACTATGAACTGATCTCTAAGGAACCCAAACCTTTTGTGTTTGAGGGGAAGGCTCGGGGCCCCATTGTAGTTCCCACAGCTGGAGAGGAGGTACCTGGGAATTCAGGGAGCGTAAAGAAAGGAGTGGTAATGAAGGAGAGAGCAAGTCCTAAAGGAGAGGAAGCCAAGGAAGACCCTAAGGGCCACGACAGGACACTGCCGCAGCAGCTGGGTGGCCAGAGCAGAGTGGCCCCCTCAGCCCACAGCTTCAACAATGATCTTGTGAAGGCCCTAGACCGAATCACACTGCAGAATGTTCCTTCGCAAGTAGCCTCGGGCTTGAACGCAGGAATGAGGAAGGACTTTGGTCTCCCTCTCACTGTCCTCTCATGCACGAAAGCTTGTCCTCACGTGGCTAAGTGTGGAAGTACTCTCTTTGAAGGGCGGACGGTACATCTTGGGAAGCTGTGTTGTACTGGAGTTGAAACGGAAGATGACGAAGACACTGAGTCCCACTCATCAACAGAGCAGGCCCCCTCTGTTGAAGCCTCTGATGGACCAACACTGCACGACCCAGACCTCTATATTGAGATTGTGAAAAATACGAAGTCCGTTCCAGAATACTCAGAGGTGGCTTATCCTGATTATTTTGGTCACATTCCACCTCCCTTCAAAGAGCCTATTTTAGAAAGGCCTTATGGTGTACAAAGGACAAAAATTGCCCAAGACATCGAGAGGCTGATACACCAGAACGATATCATAGACCGCGTGGTGTATGACTTAGACAACCCTACCTATACCACTCCAGAAGAAGGAGATACTTTGAAGTTTAACTCAAAATTCGAATCTGGGAATCTGCGCAAAGTAATTCAAATTAGAAAAAGCGAGTACGACCTTATCCTGAACTCTGATATAAACAGTAACCATTACCACCAGTGGTTCTACTTTGAAGTCAGTGGGATGCGGCCTGGTGTGGCATATAGGTTCAACATCATCAACTGTGAGAAGTCCAACAGTCAGTTTAATTATGGTATGCAGCCACTTATGTATTCAGTTCAGGAAGCACTAAATGCCAGACCATGGTGGATCCGTATGGGCACTGACATTTGTTACTACAAAAATCACTTCTCACGAAGCTCAGTTGCCGCAGGCGGACAGAAGGGCAAGTCCTACTACACCATCACCTTCACCGTGAACTTCCCGCACAAGGACGATGTCTGCTATTTCGCCTATCACTATCCATACACGTACTCGACTCTGCAGATGCATCTTCAAAAATTGGAATCGGCACACAATCCTCAACAAATCTATTTTCGAAAAGACGTGTTGTGTGAAACCTTGTCTGGAAACATCTGTCCTTTGGTGACCATAACAGCAATGCCAGAGTCCAATTACTATGAACATATCTGTCAGTTCAGAACTCGCCCTTATATTTTCTTGTCTGCTCGGGTCCATCCTGGAGAAACCAATGCAAGCTGGGTAATGAAAGGAACACTGGAGTACCTCATGAGCAATAGCCCGACTGCCCAGAGCCTACGGGAGTCTTACATTTTTAAAATTGTCCCCATGCTAAATCCAGATGGTGTCATCAATGGAAATCACCGCTGCTCCTTAAGTGGAGAGGATTTGAACAGACAGTGGCAAAGTCCAAACCCAGAGTTACACCCCACGATTTATCATGCCAAGGGGCTGCTGCAGTACCTGGCCGCGGTGAAGCGCCTACCTCTGATTATCTGCAATGCTGGAATGAAGTAA

Peptide sequence:

MSKLKVVGEKSLTNSSRVVGLLAQLEKINTDSTESDTARYVTSKILHLAQSQEKTRREMTTKGSTGMEVLLSTLENTKDLQTVLNILSILIELVSSGGGRRASFLVAKGGSQILLQLLMNASKDSPPHEEVMVQTHSILAKIGPKDKKFGVKARVNGALTVTLNLVKQHFQNYRLVLPCLQLLRVYSTNSVNSVSLGKNGVVELMFKIIGPFSKKNSGLMKVALDTLAALLKSKTNARRAVDRGYVQVLLTIYVDWHRHDNRHRNMLIRKGILQSLKSVTNIKLGRKAFIDANGMKILYNTSQECLAVRTLDPLVNTSSLIMRKCFPKNRLPLPTIKSSFHFQLPIIPVTGPVAQLYSLPPEVDDVVDESDDNDDIDLEVENELENEDDLDQSFKNDDIETDINKLRPQQVPGRTIEELKMYEHLFPELVDDFQDYELISKEPKPFVFEGKARGPIVVPTAGEEVPGNSGSVKKGVVMKERASPKGEEAKEDPKGHDRTLPQQLGGQSRVAPSAHSFNNDLVKALDRITLQNVPSQVASGLNAGMRKDFGLPLTVLSCTKACPHVAKCGSTLFEGRTVHLGKLCCTGVETEDDEDTESHSSTEQAPSVEASDGPTLHDPDLYIEIVKNTKSVPEYSEVAYPDYFGHIPPPFKEPILERPYGVQRTKIAQDIERLIHQNDIIDRVVYDLDNPTYTTPEEGDTLKFNSKFESGNLRKVIQIRKSEYDLILNSDINSNHYHQWFYFEVSGMRPGVAYRFNIINCEKSNSQFNYGMQPLMYSVQEALNARPWWIRMGTDICYYKNHFSRSSVAAGGQKGKSYYTITFTVNFPHKDDVCYFAYHYPYTYSTLQMHLQKLESAHNPQQIYFRKDVLCETLSGNICPLVTITAMPESNYYEHICQFRTRPYIFLSARVHPGETNASWVMKGTLEYLMSNSPTAQSLRESYIFKIVPMLNPDGVINGNHRCSLSGEDLNRQWQSPNPELHPTIYHAKGLLQYLAAVKRLPLIICNAGMK

IRESfinder result

IRESfinder score

0.585174862

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page