top of page

mmu_circAggf1_1308

Basic information of circular RNA
PanCircBase ID:

mmu_circAggf1_1308

mm39_Chr. Position ID:

chr13|95493704|95507467|-

Gene name:

Aggf1

Transcript:

ENSMUST00000022189.9

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

8

Exon/intron indexes:

10,9,8,7,6,5,4,3

Exon/intron offsets:

0,1513,5272,5640,7484,11183,12200,13560

Genomic length:

13763

Exon/intron sizes in nt:

16,61,02,52,11,23,22,10,00,00,000

Flanking exon/introns:

chr13:95492983-95493704|chr13:95507467-95508048

Splice length:

1308

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

ATTATTACTATCAGACATGTTATAATGACGACAGTCTTCCCAGTAAAGAGACGGAGCTGTGTGTACAGCAGAGTCAGTGTGCTCAGGCTTCCGCTCTTGATCCTCAGGACGAGTCACACATAGACAGCGGGAGTTATGCTGGTGCTGATGCCACAGAAGGTGTTAGCCATAGACAGGAGGACGCCGTCACCTCTGACTCACAGGAGAGTGTGTCCGCGCTAGCAGAAGGCCCAGCACTCGAAGGGTCCTCGCTTGCTGAGAGCTTGAGAGCTGCAGCGGAGGCTGCTGTGTCGCAGACCGGCTTCACCTACGACGAGAGCACGGGCTTATATTTTGACCACAGCACTGGTTTCTATTATGATTCTGAAAACCAGCTGTATTATGACCCTTCCACGGGGATTTATTACTACTGCGATGTGGAGAGTGGTCGGTACCAGTTTCACTCTCGCGTAGACCTGCAGCCTTACCAGACCTCTAGCACAAAACCAAACAGAGAAAGAAGACTGAAGAAGAGAAGAAAGGAGCCAGGTTTTTATACAGCAAATGAAGAAAAGGATTTGAGCTCAGAAGATCAGAAAGTCTGCAGTGTAGAATATATAAACTGCAGTGAGGATGAACATTCTGGAAATGTGAAAAAGAAGGCCAGAACAGACACTTCTCACAAAAGCAGTCCCTTACAGCTCACGGTGGCAGTTAGTGGAGACACTGTGGAGTCTCCTGGAGATGATAACTCAGCGTCATCTAAGGATGAGAGAATCGGAGAGAGTGAGAGCGAGCCGGAAGAAGGTGAGATCACAGACTCTCAGAGTGAGAAGAGCTATGATGGAGACAGTAGCAGTGGGGACAGGGAGACCTCAGAAGAATCCGACGATGAAGATGAGGAAAGAATTTGGCCGCCCTGTATTCGCGTGATTGTCATTAGGTCTCCAGTGTTGCAGATGGGCTCGCTGTTCATCATCACCGCTGTGAGCCCAGCCACCATTGGGAGAGAGAAGGACATGGAGCATACTGTGAGAATCCCTGAAGTCGCTGTTAGTAAGTTCCACGCAGAAGTTTACTTCGACCATGACTTGCAAAGCTACGTTCTTGTGGATCAGGGCAGCCAGAATGGTACCATTGTCAACGGGAAACAGATTCTTCAGCCAAAAACTAAATGTGATCCTTACGTCCTCGAACACGGCGACGAAGTGAAAATTGGGGAGACTGTGCTGTCTTTTCACATTCACCCTGGCAGTGAGACGTGCGATGGCTGTGAGCCGGGGCAGGTCAGAGCTCACCTCCGCCTCGATAGAAAGGACGAGCCTCTGG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

ACATTCACCCTGGCAGTGAG

59.96

TGAGCACACTGACTCTGCTG

59.97

175

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

ACATTCACCCTGGCAGTGAG

59.96

GAGCACACTGACTCTGCTGT

59.97

174

PCR template sequence:

CTGTCTTTTCACATTCACCCTGGCAGTGAGACGTGCGATGGCTGTGAGCCGGGGCAGGTCAGAGCTCACCTCCGCCTCGATAGAAAGGACGAGCCTCTGGATTATTACTATCAGACATGTTATAATGACGACAGTCTTCCCAGTAAAGAGACGGAGCTGTGTGTACAGCAGAGTCAGTGTGCTCAGGCTTCCGCTCTTGA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

16

Interacting miRNAs (#binding sites)

mmu-miR-673-5p(2), mmu-miR-23b-3p(1), mmu-miR-200a-3p(1), mmu-miR-27b-3p(1), mmu-miR-27a-3p(1), mmu-miR-7b-5p(1), mmu-miR-29a-3p(1), mmu-miR-7a-5p(1), mmu-miR-23a-3p(1), mmu-miR-339-5p(1), mmu-miR-149-5p(1), mmu-miR-676-3p(1), mmu-miR-182-5p(1), mmu-miR-541-5p(1), mmu-miR-369-3p(1), mmu-miR-338-3p(1)

siRNAs for circular RNA silencing
Junction sequence

GACGAGCCTCTGGATTATTACTATCA

siRNA sets

TAGTAATAATCCAGAGGCT,ATAGTAATAATCCAGAGGC,GATAGTAATAATCCAGAGG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCAGGF1_1308_ORF_1

1.2102

0.304551577

0.999966141

1677

ORF sequence:

ATGGGCTCGCTGTTCATCATCACCGCTGTGAGCCCAGCCACCATTGGGAGAGAGAAGGACATGGAGCATACTGTGAGAATCCCTGAAGTCGCTGTTAGTAAGTTCCACGCAGAAGTTTACTTCGACCATGACTTGCAAAGCTACGTTCTTGTGGATCAGGGCAGCCAGAATGGTACCATTGTCAACGGGAAACAGATTCTTCAGCCAAAAACTAAATGTGATCCTTACGTCCTCGAACACGGCGACGAAGTGAAAATTGGGGAGACTGTGCTGTCTTTTCACATTCACCCTGGCAGTGAGACGTGCGATGGCTGTGAGCCGGGGCAGGTCAGAGCTCACCTCCGCCTCGATAGAAAGGACGAGCCTCTGGATTATTACTATCAGACATGTTATAATGACGACAGTCTTCCCAGTAAAGAGACGGAGCTGTGTGTACAGCAGAGTCAGTGTGCTCAGGCTTCCGCTCTTGATCCTCAGGACGAGTCACACATAGACAGCGGGAGTTATGCTGGTGCTGATGCCACAGAAGGTGTTAGCCATAGACAGGAGGACGCCGTCACCTCTGACTCACAGGAGAGTGTGTCCGCGCTAGCAGAAGGCCCAGCACTCGAAGGGTCCTCGCTTGCTGAGAGCTTGAGAGCTGCAGCGGAGGCTGCTGTGTCGCAGACCGGCTTCACCTACGACGAGAGCACGGGCTTATATTTTGACCACAGCACTGGTTTCTATTATGATTCTGAAAACCAGCTGTATTATGACCCTTCCACGGGGATTTATTACTACTGCGATGTGGAGAGTGGTCGGTACCAGTTTCACTCTCGCGTAGACCTGCAGCCTTACCAGACCTCTAGCACAAAACCAAACAGAGAAAGAAGACTGAAGAAGAGAAGAAAGGAGCCAGGTTTTTATACAGCAAATGAAGAAAAGGATTTGAGCTCAGAAGATCAGAAAGTCTGCAGTGTAGAATATATAAACTGCAGTGAGGATGAACATTCTGGAAATGTGAAAAAGAAGGCCAGAACAGACACTTCTCACAAAAGCAGTCCCTTACAGCTCACGGTGGCAGTTAGTGGAGACACTGTGGAGTCTCCTGGAGATGATAACTCAGCGTCATCTAAGGATGAGAGAATCGGAGAGAGTGAGAGCGAGCCGGAAGAAGGTGAGATCACAGACTCTCAGAGTGAGAAGAGCTATGATGGAGACAGTAGCAGTGGGGACAGGGAGACCTCAGAAGAATCCGACGATGAAGATGAGGAAAGAATTTGGCCGCCCTGTATTCGCGTGATTGTCATTAGGTCTCCAGTGTTGCAGATGGGCTCGCTGTTCATCATCACCGCTGTGAGCCCAGCCACCATTGGGAGAGAGAAGGACATGGAGCATACTGTGAGAATCCCTGAAGTCGCTGTTAGTAAGTTCCACGCAGAAGTTTACTTCGACCATGACTTGCAAAGCTACGTTCTTGTGGATCAGGGCAGCCAGAATGGTACCATTGTCAACGGGAAACAGATTCTTCAGCCAAAAACTAAATGTGATCCTTACGTCCTCGAACACGGCGACGAAGTGAAAATTGGGGAGACTGTGCTGTCTTTTCACATTCACCCTGGCAGTGAGACGTGCGATGGCTGTGAGCCGGGGCAGGTCAGAGCTCACCTCCGCCTCGATAGAAAGGACGAGCCTCTG

Peptide sequence:

MGSLFIITAVSPATIGREKDMEHTVRIPEVAVSKFHAEVYFDHDLQSYVLVDQGSQNGTIVNGKQILQPKTKCDPYVLEHGDEVKIGETVLSFHIHPGSETCDGCEPGQVRAHLRLDRKDEPLDYYYQTCYNDDSLPSKETELCVQQSQCAQASALDPQDESHIDSGSYAGADATEGVSHRQEDAVTSDSQESVSALAEGPALEGSSLAESLRAAAEAAVSQTGFTYDESTGLYFDHSTGFYYDSENQLYYDPSTGIYYYCDVESGRYQFHSRVDLQPYQTSSTKPNRERRLKKRRKEPGFYTANEEKDLSSEDQKVCSVEYINCSEDEHSGNVKKKARTDTSHKSSPLQLTVAVSGDTVESPGDDNSASSKDERIGESESEPEEGEITDSQSEKSYDGDSSSGDRETSEESDDEDEERIWPPCIRVIVIRSPVLQMGSLFIITAVSPATIGREKDMEHTVRIPEVAVSKFHAEVYFDHDLQSYVLVDQGSQNGTIVNGKQILQPKTKCDPYVLEHGDEVKIGETVLSFHIHPGSETCDGCEPGQVRAHLRLDRKDEPL

IRESfinder result

IRESfinder score

0.443776893

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page