top of page

mmu_circAfg3l2_1000

Basic information of circular RNA
PanCircBase ID:

mmu_circAfg3l2_1000

mm39_Chr. Position ID:

chr18|67554055|67567299|-

Gene name:

Afg3l2

Transcript:

ENSMUST00000025408.10

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

7

Exon/intron indexes:

12,11,10,9,8,7,6

Exon/intron offsets:

0,222,1959,4903,7995,10668,13169

Genomic length:

13244

Exon/intron sizes in nt:

126,108,154,138,274,125,75

Flanking exon/introns:

chr18:67548679-67554055|chr18:67567299-67573251

Splice length:

1000

Other database IDs:

CIRCpedia: MMU_CIRCpedia_37002, circAtlas: mmu-Afg3l2_0007

circAtlas: hsa-AFG3L2_0015, CIRCpedia: HSA_CIRCpedia_162837

Human Ortholog IDs:
Mature spliced Sequence:

GTGGACAGACTAGAAGTTGTCAACAAGCGTTTTGTTCGTGTGACCTTTACACCAGGAAAAACTCCGGTTGATGGGCAATACGTCTGGTTTAATATTGGCAGTGTTGACACATTTGAGCGGAATCTGGAGACTTTGCAGCAAGAATTGGGCATAGAAGGGGAGAACCGGGTCCCTGTGGTTTATATTGCTGAGAGCGATGGCTCCTTCCTGCTGAGCATGTTGCCCACCGTACTCATTATCGCTTTTCTACTCTACACCATAAGAAGAGGGCCCGCTGGCATTGGTCGGACCGGCCGGGGAATGGGTGGACTCTTCAGCGTTGGGGAAACCACAGCCAAGGTCTTAAAGGATGAGATAGATGTGAAGTTTAAAGATGTGGCTGGCTGTGAGGAGGCCAAGCTAGAAATAATGGAATTCGTGAATTTCTTGAAAAACCCAAAGCAATATCAAGACCTAGGAGCAAAAATCCCAAAGGGTGCCATTCTCACCGGTCCCCCAGGTACTGGGAAGACGCTGCTAGCTAAGGCCACAGCTGGAGAAGCCAATGTCCCCTTTATCACTGTGAGCGGATCTGAGTTTCTGGAGATGTTTGTTGGCGTTGGTCCAGCCAGAGTCCGAGACTTATTTGCCCTTGCTCGGAAGAATGCGCCTTGCATTCTCTTCATTGATGAGATTGATGCTGTGGGAAGGAAGCGCGGCAGAGGCAACTTCGGTGGGCAGAGCGAGCAGGAGAACACACTCAACCAGCTGCTTGTGGAGATGGACGGCTTCAACACAACCACCAATGTGGTCATCCTGGCAGGCACAAATCGACCAGACATCCTGGATCCAGCTCTGTTGAGACCAGGCCGCTTTGACAGGCAGATTTTTATTGGACCCCCAGACATAAAAGGACGAGCCTCAATCTTCAAAGTTCACCTTCGACCATTGAAGCTGGACAGTGCCTTGGAAAAAGATAAATTGGCCAGAAAACTGGCGTCCTTAACTCCAGGGTTTTCAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TTGAAGCTGGACAGTGCCTT

59.82

ATTGCCCATCAACCGGAGTT

59.96

152

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TTGAAGCTGGACAGTGCCTT

59.82

TGCCCATCAACCGGAGTTTT

60.18

150

PCR template sequence:

TCAATCTTCAAAGTTCACCTTCGACCATTGAAGCTGGACAGTGCCTTGGAAAAAGATAAATTGGCCAGAAAACTGGCGTCCTTAACTCCAGGGTTTTCAGGTGGACAGACTAGAAGTTGTCAACAAGCGTTTTGTTCGTGTGACCTTTACACCAGGAAAAACTCCGGTTGATGGGCAATACGTCTGGTTTAATATTGGCA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

10

Interacting miRNAs (#binding sites)

mmu-miR-200a-3p(1), mmu-miR-141-3p(1), mmu-miR-27b-3p(1), mmu-miR-27a-3p(1), mmu-miR-495-3p(1), mmu-miR-129-5p(1), mmu-miR-207(1), mmu-miR-300-3p(1), mmu-miR-452-3p(1), mmu-miR-3065-5p(1)

siRNAs for circular RNA silencing
Junction sequence

CCAGGGTTTTCAGGTGGACAGACTAG

siRNA sets

TCTGTCCACCTGAAAACCC, TGTCCACCTGAAAACCCTG, CTGTCCACCTGAAAACCCT

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCAFG3L2_1000_ORF_1

0.978

0.221883237

0.973558357

855

ORF sequence:

ATGTTGCCCACCGTACTCATTATCGCTTTTCTACTCTACACCATAAGAAGAGGGCCCGCTGGCATTGGTCGGACCGGCCGGGGAATGGGTGGACTCTTCAGCGTTGGGGAAACCACAGCCAAGGTCTTAAAGGATGAGATAGATGTGAAGTTTAAAGATGTGGCTGGCTGTGAGGAGGCCAAGCTAGAAATAATGGAATTCGTGAATTTCTTGAAAAACCCAAAGCAATATCAAGACCTAGGAGCAAAAATCCCAAAGGGTGCCATTCTCACCGGTCCCCCAGGTACTGGGAAGACGCTGCTAGCTAAGGCCACAGCTGGAGAAGCCAATGTCCCCTTTATCACTGTGAGCGGATCTGAGTTTCTGGAGATGTTTGTTGGCGTTGGTCCAGCCAGAGTCCGAGACTTATTTGCCCTTGCTCGGAAGAATGCGCCTTGCATTCTCTTCATTGATGAGATTGATGCTGTGGGAAGGAAGCGCGGCAGAGGCAACTTCGGTGGGCAGAGCGAGCAGGAGAACACACTCAACCAGCTGCTTGTGGAGATGGACGGCTTCAACACAACCACCAATGTGGTCATCCTGGCAGGCACAAATCGACCAGACATCCTGGATCCAGCTCTGTTGAGACCAGGCCGCTTTGACAGGCAGATTTTTATTGGACCCCCAGACATAAAAGGACGAGCCTCAATCTTCAAAGTTCACCTTCGACCATTGAAGCTGGACAGTGCCTTGGAAAAAGATAAATTGGCCAGAAAACTGGCGTCCTTAACTCCAGGGTTTTCAGGTGGACAGACTAGAAGTTGTCAACAAGCGTTTTGTTCGTGTGACCTTTACACCAGGAAAAACTCCGGTTGA

Peptide sequence:

MLPTVLIIAFLLYTIRRGPAGIGRTGRGMGGLFSVGETTAKVLKDEIDVKFKDVAGCEEAKLEIMEFVNFLKNPKQYQDLGAKIPKGAILTGPPGTGKTLLAKATAGEANVPFITVSGSEFLEMFVGVGPARVRDLFALARKNAPCILFIDEIDAVGRKRGRGNFGGQSEQENTLNQLLVEMDGFNTTTNVVILAGTNRPDILDPALLRPGRFDRQIFIGPPDIKGRASIFKVHLRPLKLDSALEKDKLARKLASLTPGFSGGQTRSCQQAFCSCDLYTRKNSG

IRESfinder result

IRESfinder score

0.504932608

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page