top of page

mmu_circAdgrl3_1915

Basic information of circular RNA
PanCircBase ID:

mmu_circAdgrl3_1915

mm39_Chr. Position ID:

chr5|81794256|81888993|+

Gene name:

Adgrl3

Transcript:

ENSMUST00000132375.8

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

12

Exon/intron indexes:

9,10,11,12,13,14,15,16,17,18,19,20

Exon/intron offsets:

0,2219,13852,16976,42099,43155,47083,48041,77652,80259,92617,94645

Genomic length:

94737

Exon/intron sizes in nt:

303,104,186,39,184,123,209,177,210,221,67,92

Flanking exon/introns:

chr5:81708790-81794256|chr5:81888993-81905832

Splice length:

1915

Other database IDs:

circBase: mmu_circ_0012812, CIRCpedia: MMU_CIRCpedia_30900, circAtlas: mmu-Lphn3_0037

circAtlas: hsa-ADGRL3_0003, CIRCpedia: HSA_CIRCpedia_48953

Human Ortholog IDs:
Mature spliced Sequence:

GGATTTCTACCACAGGATCCCTGGGTATGGGAAGCACGACCACCAGCACCACCCTCCGGACCACAACCTGGAACATAGGCAGGAGTACCACCGCATCCTTGCCGGGCAGAAGAAACCGCAGTACCAGCACGCCATCCCCCGCGGTAGAGGTGCTGGATGACGTCACCACACACCTGCCCTCGGCAGCCTCCCAAATCCCAGCTATGGAAGAGAGCTGCGAGGCTGTGGAAGCCCGAGAAATCATGTGGTTTAAGACCAGACAGGGGCAGGTAGCAAAGCAGCCATGCCCAGCAGGAACCATAGGTGTATCAACTTACCTATGTCTTGCTCCTGATGGAATATGGGACCCCCAAGGACCAGATCTCAGCAACTGCTCTTCTCCTTGGGTCAATCACATAACACAGAAGCTGAAATCCGGAGAAACAGCTGCCAATATTGCCAGAGAGCTAGCAGAACAGACAAGAAATCACTTGAACGCTGGGGACATCACCTACTCTGTCCGTGCCATGGACCAGCTGGTTGGCCTCTTGGATGTCCAGCTCAGGAATTTGACACCAGGGGGAAAAGACAGCGCAGCCCGCAGCTTGAACAAGCTTCAGAAAAGAGAGCGCTCTTGCAGAGCCTATGTCCAGGCGATGGTGGAGACAGTTAACAACCTCCTTCAGCCACAAGCTTTGAATGCCTGGAGAGACCTGACGACAAGTGATCAACTGCGTGCGGCCACCATGTTGCTTGACACTGTGGAGGAGAGCGCTTTCGTGTTAGCTGATAACCTTTTGAAGACCGACATTGTCAGGGAGAATACAGACAATATTCAGTTAGAAGTTGCAAGACTGAGCACGGAAGGAAACCTAGAAGATCTAAAATTCCCAGAGAACATGGGCCACGGAAGTACCATCCAGCTCTCAGCAAACACATTAAAGCAAAATGGCCGGAATGGAGAGATTAGAGTGGCTTTTGTCCTGTATAATAACCTGGGTCCTTATTTGTCTACGGAGAATGCCAGTATGAAGTTGGGCACAGAAGCTATGTCCACAAATCACTCGGTTATCGTCAATTCCCCTGTTATTACAGCAGCAATAAATAAGGAATTCAGTAATAAAGTGTATTTGGCTGATCCTGTGGTATTTACTGTTAAACACATCAAGCAGTCAGAAGAAAATTTCAACCCTAACTGTTCATTTTGGAGCTATTCCAAGCGCACAATGACAGGTTATTGGTCAACACAAGGCTGTCGACTCCTGACAACCAACAAGACACATACTACATGCTCCTGTAACCACCTCACCAACTTTGCAGTATTGATGGCACATGTGGAAGTTAAGCACAGCGATGCAGTCCACGATCTTCTTCTGGATGTGATCACGTGGGTTGGCATCTTGCTGTCCCTTGTCTGTCTCCTGATTTGCATCTTCACATTCTGCTTCTTCCGGGGACTCCAGAGTGACCGCAACACCATTCACAAGAACCTCTGCATCAGCCTGTTCGTGGCAGAACTGCTCTTCCTGATTGGAATCAACAGAACCGACCAACCAATTGCCTGTGCAGTGTTCGCGGCTCTTTTGCATTTCTTCTTCTTGGCGGCCTTCACCTGGATGTTTCTAGAAGGGGTGCAGCTGTATATCATGCTGGTGGAGGTCTTTGAGAGCGAGCATTCCCGTAGGAAGTACTTTTATCTGGTCGGCTATGGGATGCCCGCGCTCATCGTGGCCGTTTCTGCGGCCGTCGACTACAGGAGCTACGGAACAGACAAAGTATGTTGGCTTCGCCTTGACACCTACTTCATTTGGAGTTTTATAGGACCGGCGACCTTGATAATTATGCTGAATGTCATCTTCCTTGGGATTGCTTTATACAAAATGTTTCACCATACTGCCATACTGAAACCTGAATCAGGCTGTCTTGACAATATCAA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TGTCATCTTCCTTGGGATTGCT

59.69

CGGTGGTACTCCTGCCTATG

59.61

180

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TGTCATCTTCCTTGGGATTGC

58.27

CGGTGGTACTCCTGCCTATG

59.61

180

PCR template sequence:

TAATTATGCTGAATGTCATCTTCCTTGGGATTGCTTTATACAAAATGTTTCACCATACTGCCATACTGAAACCTGAATCAGGCTGTCTTGACAATATCAAGGATTTCTACCACAGGATCCCTGGGTATGGGAAGCACGACCACCAGCACCACCCTCCGGACCACAACCTGGAACATAGGCAGGAGTACCACCGCATCCTT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

22

Interacting miRNAs (#binding sites)

mmu-miR-200c-3p(2), mmu-miR-137-3p(1), mmu-miR-200a-3p(1), mmu-miR-141-3p(1), mmu-miR-1a-3p(1), mmu-miR-200b-3p(1), mmu-miR-181a-5p(1), mmu-miR-31-5p(1), mmu-miR-324-5p(1), mmu-miR-138-5p(1), mmu-miR-494-3p(1), mmu-miR-218-5p(1), mmu-miR-370-3p(1), mmu-miR-183-5p(1), mmu-miR-340-5p(1), mmu-miR-1198-5p(1), mmu-miR-300-3p(1), mmu-miR-5101(1), mmu-miR-3470b(1), mmu-miR-670-5p(1), mmu-miR-1904(1), mmu-miR-181d-5p(1)

siRNAs for circular RNA silencing
Junction sequence

TTGACAATATCAAGGATTTCTACCAC

siRNA sets

GAAATCCTTGATATTGTCA, TAGAAATCCTTGATATTGT, AGAAATCCTTGATATTGTC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCADGRL3_1915_ORF_1

0.9852

0.205068845

0.999994573

2049

ORF sequence:

ATGGGAAGCACGACCACCAGCACCACCCTCCGGACCACAACCTGGAACATAGGCAGGAGTACCACCGCATCCTTGCCGGGCAGAAGAAACCGCAGTACCAGCACGCCATCCCCCGCGGTAGAGGTGCTGGATGACGTCACCACACACCTGCCCTCGGCAGCCTCCCAAATCCCAGCTATGGAAGAGAGCTGCGAGGCTGTGGAAGCCCGAGAAATCATGTGGTTTAAGACCAGACAGGGGCAGGTAGCAAAGCAGCCATGCCCAGCAGGAACCATAGGTGTATCAACTTACCTATGTCTTGCTCCTGATGGAATATGGGACCCCCAAGGACCAGATCTCAGCAACTGCTCTTCTCCTTGGGTCAATCACATAACACAGAAGCTGAAATCCGGAGAAACAGCTGCCAATATTGCCAGAGAGCTAGCAGAACAGACAAGAAATCACTTGAACGCTGGGGACATCACCTACTCTGTCCGTGCCATGGACCAGCTGGTTGGCCTCTTGGATGTCCAGCTCAGGAATTTGACACCAGGGGGAAAAGACAGCGCAGCCCGCAGCTTGAACAAGCTTCAGAAAAGAGAGCGCTCTTGCAGAGCCTATGTCCAGGCGATGGTGGAGACAGTTAACAACCTCCTTCAGCCACAAGCTTTGAATGCCTGGAGAGACCTGACGACAAGTGATCAACTGCGTGCGGCCACCATGTTGCTTGACACTGTGGAGGAGAGCGCTTTCGTGTTAGCTGATAACCTTTTGAAGACCGACATTGTCAGGGAGAATACAGACAATATTCAGTTAGAAGTTGCAAGACTGAGCACGGAAGGAAACCTAGAAGATCTAAAATTCCCAGAGAACATGGGCCACGGAAGTACCATCCAGCTCTCAGCAAACACATTAAAGCAAAATGGCCGGAATGGAGAGATTAGAGTGGCTTTTGTCCTGTATAATAACCTGGGTCCTTATTTGTCTACGGAGAATGCCAGTATGAAGTTGGGCACAGAAGCTATGTCCACAAATCACTCGGTTATCGTCAATTCCCCTGTTATTACAGCAGCAATAAATAAGGAATTCAGTAATAAAGTGTATTTGGCTGATCCTGTGGTATTTACTGTTAAACACATCAAGCAGTCAGAAGAAAATTTCAACCCTAACTGTTCATTTTGGAGCTATTCCAAGCGCACAATGACAGGTTATTGGTCAACACAAGGCTGTCGACTCCTGACAACCAACAAGACACATACTACATGCTCCTGTAACCACCTCACCAACTTTGCAGTATTGATGGCACATGTGGAAGTTAAGCACAGCGATGCAGTCCACGATCTTCTTCTGGATGTGATCACGTGGGTTGGCATCTTGCTGTCCCTTGTCTGTCTCCTGATTTGCATCTTCACATTCTGCTTCTTCCGGGGACTCCAGAGTGACCGCAACACCATTCACAAGAACCTCTGCATCAGCCTGTTCGTGGCAGAACTGCTCTTCCTGATTGGAATCAACAGAACCGACCAACCAATTGCCTGTGCAGTGTTCGCGGCTCTTTTGCATTTCTTCTTCTTGGCGGCCTTCACCTGGATGTTTCTAGAAGGGGTGCAGCTGTATATCATGCTGGTGGAGGTCTTTGAGAGCGAGCATTCCCGTAGGAAGTACTTTTATCTGGTCGGCTATGGGATGCCCGCGCTCATCGTGGCCGTTTCTGCGGCCGTCGACTACAGGAGCTACGGAACAGACAAAGTATGTTGGCTTCGCCTTGACACCTACTTCATTTGGAGTTTTATAGGACCGGCGACCTTGATAATTATGCTGAATGTCATCTTCCTTGGGATTGCTTTATACAAAATGTTTCACCATACTGCCATACTGAAACCTGAATCAGGCTGTCTTGACAATATCAAGGATTTCTACCACAGGATCCCTGGGTATGGGAAGCACGACCACCAGCACCACCCTCCGGACCACAACCTGGAACATAGGCAGGAGTACCACCGCATCCTTGCCGGGCAGAAGAAACCGCAGTACCAGCACGCCATCCCCCGCGGTAGAGGTGCTGGATGA

Peptide sequence:

MGSTTTSTTLRTTTWNIGRSTTASLPGRRNRSTSTPSPAVEVLDDVTTHLPSAASQIPAMEESCEAVEAREIMWFKTRQGQVAKQPCPAGTIGVSTYLCLAPDGIWDPQGPDLSNCSSPWVNHITQKLKSGETAANIARELAEQTRNHLNAGDITYSVRAMDQLVGLLDVQLRNLTPGGKDSAARSLNKLQKRERSCRAYVQAMVETVNNLLQPQALNAWRDLTTSDQLRAATMLLDTVEESAFVLADNLLKTDIVRENTDNIQLEVARLSTEGNLEDLKFPENMGHGSTIQLSANTLKQNGRNGEIRVAFVLYNNLGPYLSTENASMKLGTEAMSTNHSVIVNSPVITAAINKEFSNKVYLADPVVFTVKHIKQSEENFNPNCSFWSYSKRTMTGYWSTQGCRLLTTNKTHTTCSCNHLTNFAVLMAHVEVKHSDAVHDLLLDVITWVGILLSLVCLLICIFTFCFFRGLQSDRNTIHKNLCISLFVAELLFLIGINRTDQPIACAVFAALLHFFFLAAFTWMFLEGVQLYIMLVEVFESEHSRRKYFYLVGYGMPALIVAVSAAVDYRSYGTDKVCWLRLDTYFIWSFIGPATLIIMLNVIFLGIALYKMFHHTAILKPESGCLDNIKDFYHRIPGYGKHDHQHHPPDHNLEHRQEYHRILAGQKKPQYQHAIPRGRGAG

IRESfinder result

IRESfinder score

0.484130532

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page