top of page

mmu_circAdgrf5_1732

Basic information of circular RNA
PanCircBase ID:

mmu_circAdgrf5_1732

mm39_Chr. Position ID:

chr17|43721392|43752893|+

Gene name:

Adgrf5

Transcript:

ENSMUST00000226087.2

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

11

Exon/intron indexes:

3,4,5,6,7,8,9,10,11,12,13

Exon/intron offsets:

0,11996,13913,14212,15783,16437,17943,20002,27014,29449,31282

Genomic length:

31501

Exon/intron sizes in nt:

55,15,91,77,11,05,91,40,00,00,00,00,00,00,000

Flanking exon/introns:

chr17:43714934-43721392|chr17:43752893-43755877

Splice length:

1732

Other database IDs:

circAtlas: mmu-Gpr116_0004

Human Ortholog IDs:
Mature spliced Sequence:

ATTCTCCAAGAACATGAGCTAGCCGGGGAAGAGCTACTGAGGCCAAAAAGAGCAGCTGCAGCGGGTGATCGCGTGGCGGAAGAATACATGGTGGATATTGAGATCAGCTTTGAAAATGTCTCCTTCCTGGAGTCCATCAGAGCTCACTTGAACAACCTCAGTTTTCCAATTCGAGGGACCGAAGCTGACATTTTGAACATAGCAATGACTACAGTCTGCACTCCTGCTGGAAATGACCTCTTGTGCTTCTGTGAGAAAGGCTACCAGTGGTCTGAGGAAAGGTGTCTCCACTCTCTCACTTGTCAAGACTATGACAGTGCCCTGCCAGGCGGCTACTGCAGTTGTCTGAAAGGACTTCCTCCCCAGGGACCTTTCTGCCAGCTCCCAGAAGCATTCATTACCTTAAAACTCAAAGTCAGACTGAACATAGGATTTCAAGAAGACCTAAAGAACACGTCTTCTGCCCTCTATAGGTCCTACAAGACTGATCTGGAAAGAGCGTTCCGAGCGGGTTACAGAACTTTACCAGGATTCAGATCGGTGACTGTGACACAGTTCACCAAGGGCAGCGTGGTTGTGAACTACGTAGTCCGGGTTACATCGGCACCACTGCCTGGATCTATTCATAAAGCCAATGAACAAGTCATACAGAACCTCAACCATACTTACAAAATGGACTACAACTCCTTCCAGGGAACCCCGAGCAATGAGACGAAATTCACTGTCATACCAGAATTCATCTTTGAGGGAGACAATGTGACTCTGGAGTGTGAAACTGAGTTCGTGACCTCCAACACGTCTTGGTACTATGGAGAAAAACGCTCTGACATCCAGAACAGCGACAAATACTCCATTCACACCACTGTCATCAACAATATAAGCCTGATCACCCGCCTTACCATTTACAACTTCACACAGCATGATGCGGGCATGTATGGTTGCAATGTGACATTGGATATTTTTGAATATGGAACAGTCAGAAAATTAGATGTCACTCCCATCCGGATTTTGGCCAAGGAGGAGAGAAAGGTGGTGTGTGACAACCATCCTATATCGCTGAACTGCTGCAGCGAGAATATTGCAAACTGGAGCAGTATTGAATGGAAACAGGAAGGGAAGATAAGCATTCTAGGGAACCCAGAATCAGACCTAGAGTCTAGCTGCAGCACTTACACGCTCAAGGCAGATGGAACCCAGTGTCCCAGTGGGTCTTCTGGAACAACAGTCATCTACACATGCGAGTTCGTCAGTGCCTATGGAGCCAGAGGCAGTAAGAACATAGCTGTGACCTTCACCTCTGTAGCCAACCTAACAATAACCCGGGACCCAATTTCTGTTTCTGAGGGACAAAGCTTTTCTATAACCTGCCTCAGCGATGTGAGTAGCTTTGATGAGGTGTACTGGAACACCTCAGCTGGTATTAAAATCCACCCAAGGTTTTATACCATGAGGAGGTATCAGGATGGAGCAGAGTCGGTGCTGATGGTGAAGACCTCCACCCGAGAGTGGAACGGAACCTACCACTGCATATTTAGATATAAGAATTCATACAGCATTGCCACCAAAGATGTCACCGTTCACCCGCTGCCTCTGGTGTCAGACATCATGATGGATCCTTTGGAAGCCAGTGGTCTGTGTACCAGTTCCCATCAATTCAAATGCTGCGTAGAAGAGGATGCAGGGGAAGAGTACGCTGTGACTTTCCACGTGGACTCCTCATCCTTTCCCGCTG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

AGAGGATGCAGGGGAAGAGT

59.96

CATGTATTCTTCCGCCACGC

59.7

152

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GGATGCAGGGGAAGAGTACG

59.89

CATGTATTCTTCCGCCACGC

59.7

149

PCR template sequence:

CTGTGTACCAGTTCCCATCAATTCAAATGCTGCGTAGAAGAGGATGCAGGGGAAGAGTACGCTGTGACTTTCCACGTGGACTCCTCATCCTTTCCCGCTGATTCTCCAAGAACATGAGCTAGCCGGGGAAGAGCTACTGAGGCCAAAAAGAGCAGCTGCAGCGGGTGATCGCGTGGCGGAAGAATACATGGTGGATATTG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

15

Interacting miRNAs (#binding sites)

mmu-miR-673-5p(3), mmu-miR-9-5p(1), mmu-miR-23b-3p(1), mmu-miR-429-3p(1), mmu-miR-200b-3p(1), mmu-miR-34c-5p(1), mmu-miR-200c-3p(1), mmu-miR-298-5p(1), mmu-miR-709(1), mmu-miR-23a-3p(1), mmu-miR-149-5p(1), mmu-miR-411-3p(1), mmu-miR-382-5p(1), mmu-miR-467b-5p(1), mmu-miR-224-5p(1)

siRNAs for circular RNA silencing
Junction sequence

TCCTTTCCCGCTGATTCTCCAAGAAC

siRNA sets

TTCTTGGAGAATCAGCGGG, GAGAATCAGCGGGAAAGGA, GGAGAATCAGCGGGAAAGG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRCADGRF5_1732_ORF_1

0.7711

0.211166416

0.99987244

1662

ORF sequence:

ATGGTGGATATTGAGATCAGCTTTGAAAATGTCTCCTTCCTGGAGTCCATCAGAGCTCACTTGAACAACCTCAGTTTTCCAATTCGAGGGACCGAAGCTGACATTTTGAACATAGCAATGACTACAGTCTGCACTCCTGCTGGAAATGACCTCTTGTGCTTCTGTGAGAAAGGCTACCAGTGGTCTGAGGAAAGGTGTCTCCACTCTCTCACTTGTCAAGACTATGACAGTGCCCTGCCAGGCGGCTACTGCAGTTGTCTGAAAGGACTTCCTCCCCAGGGACCTTTCTGCCAGCTCCCAGAAGCATTCATTACCTTAAAACTCAAAGTCAGACTGAACATAGGATTTCAAGAAGACCTAAAGAACACGTCTTCTGCCCTCTATAGGTCCTACAAGACTGATCTGGAAAGAGCGTTCCGAGCGGGTTACAGAACTTTACCAGGATTCAGATCGGTGACTGTGACACAGTTCACCAAGGGCAGCGTGGTTGTGAACTACGTAGTCCGGGTTACATCGGCACCACTGCCTGGATCTATTCATAAAGCCAATGAACAAGTCATACAGAACCTCAACCATACTTACAAAATGGACTACAACTCCTTCCAGGGAACCCCGAGCAATGAGACGAAATTCACTGTCATACCAGAATTCATCTTTGAGGGAGACAATGTGACTCTGGAGTGTGAAACTGAGTTCGTGACCTCCAACACGTCTTGGTACTATGGAGAAAAACGCTCTGACATCCAGAACAGCGACAAATACTCCATTCACACCACTGTCATCAACAATATAAGCCTGATCACCCGCCTTACCATTTACAACTTCACACAGCATGATGCGGGCATGTATGGTTGCAATGTGACATTGGATATTTTTGAATATGGAACAGTCAGAAAATTAGATGTCACTCCCATCCGGATTTTGGCCAAGGAGGAGAGAAAGGTGGTGTGTGACAACCATCCTATATCGCTGAACTGCTGCAGCGAGAATATTGCAAACTGGAGCAGTATTGAATGGAAACAGGAAGGGAAGATAAGCATTCTAGGGAACCCAGAATCAGACCTAGAGTCTAGCTGCAGCACTTACACGCTCAAGGCAGATGGAACCCAGTGTCCCAGTGGGTCTTCTGGAACAACAGTCATCTACACATGCGAGTTCGTCAGTGCCTATGGAGCCAGAGGCAGTAAGAACATAGCTGTGACCTTCACCTCTGTAGCCAACCTAACAATAACCCGGGACCCAATTTCTGTTTCTGAGGGACAAAGCTTTTCTATAACCTGCCTCAGCGATGTGAGTAGCTTTGATGAGGTGTACTGGAACACCTCAGCTGGTATTAAAATCCACCCAAGGTTTTATACCATGAGGAGGTATCAGGATGGAGCAGAGTCGGTGCTGATGGTGAAGACCTCCACCCGAGAGTGGAACGGAACCTACCACTGCATATTTAGATATAAGAATTCATACAGCATTGCCACCAAAGATGTCACCGTTCACCCGCTGCCTCTGGTGTCAGACATCATGATGGATCCTTTGGAAGCCAGTGGTCTGTGTACCAGTTCCCATCAATTCAAATGCTGCGTAGAAGAGGATGCAGGGGAAGAGTACGCTGTGACTTTCCACGTGGACTCCTCATCCTTTCCCGCTGATTCTCCAAGAACATGA

Peptide sequence:

MVDIEISFENVSFLESIRAHLNNLSFPIRGTEADILNIAMTTVCTPAGNDLLCFCEKGYQWSEERCLHSLTCQDYDSALPGGYCSCLKGLPPQGPFCQLPEAFITLKLKVRLNIGFQEDLKNTSSALYRSYKTDLERAFRAGYRTLPGFRSVTVTQFTKGSVVVNYVVRVTSAPLPGSIHKANEQVIQNLNHTYKMDYNSFQGTPSNETKFTVIPEFIFEGDNVTLECETEFVTSNTSWYYGEKRSDIQNSDKYSIHTTVINNISLITRLTIYNFTQHDAGMYGCNVTLDIFEYGTVRKLDVTPIRILAKEERKVVCDNHPISLNCCSENIANWSSIEWKQEGKISILGNPESDLESSCSTYTLKADGTQCPSGSSGTTVIYTCEFVSAYGARGSKNIAVTFTSVANLTITRDPISVSEGQSFSITCLSDVSSFDEVYWNTSAGIKIHPRFYTMRRYQDGAESVLMVKTSTREWNGTYHCIFRYKNSYSIATKDVTVHPLPLVSDIMMDPLEASGLCTSSHQFKCCVEEDAGEEYAVTFHVDSSSFPADSPRT

IRESfinder result

IRESfinder score

0.597534559

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page