top of page

mmu_circAblim1_221

Basic information of circular RNA
PanCircBase ID:

mmu_circAblim1_221

mm39_Chr. Position ID:

chr19|57121293|57123140|-

Gene name:

Ablim1

Transcript:

ENSMUST00000079360.12

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

2

Exon/intron indexes:

6,5

Exon/intron offsets:

0,1720

Genomic length:

1847

Exon/intron sizes in nt:

94,127

Flanking exon/introns:

chr19:57072035-57121293|chr19:57123140-57140704

Splice length:

221

Other database IDs:

circBase: mmu_circ_0007915, CIRCpedia: MMU_CIRCpedia_23758, circAtlas: mmu-Ablim1_0005

circBase: hsa_circ_0020073, circAtlas: hsa-ABLIM1_0004, CIRCpedia: HSA_CIRCpedia_469

Human Ortholog IDs:
Mature spliced Sequence:

ACTGCGCCGGCTGTGGAAGGGACATTAAGAACGGACAGGCGCTGCTAGCTCTGGACAAGCAGTGGCATTTGGGCTGCTTCAAGTGCAAGTCCTGTGGGAAGGTCCTCACCGGCGAGTACATCAGCAAGGATGGCTCCCCATACTGTGAGAAAGACTACCAGGGGCTCTTTGGGGTGAAGTGTGAAGCCTGTCACCAGTTTATCACAGGAAAAGTCCTGGAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TGGCTCCCCATACTGTGAGA

59.96

CCAAATGCCACTGCTTGTCC

60.04

163

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TGGCTCCCCATACTGTGAGA

59.96

CCCAAATGCCACTGCTTGTC

60.04

164

PCR template sequence:

CAGCAAGGATGGCTCCCCATACTGTGAGAAAGACTACCAGGGGCTCTTTGGGGTGAAGTGTGAAGCCTGTCACCAGTTTATCACAGGAAAAGTCCTGGAGACTGCGCCGGCTGTGGAAGGGACATTAAGAACGGACAGGCGCTGCTAGCTCTGGACAAGCAGTGGCATTTGGGCTGCTTCAAGTGCAAGTCCTGTGGGAA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

NA

Interacting miRNAs (#binding sites)

NA

siRNAs for circular RNA silencing
Junction sequence

AAAAGTCCTGGAGACTGCGCCGGCTG

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.316938286

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page