top of page

mmu_circ9930021J03Rik_1704

Basic information of circular RNA
PanCircBase ID:

mmu_circ9930021J03Rik_1704

mm39_Chr. Position ID:

chr19|29700789|29732417|-

Gene name:

9930021J03Rik

Transcript:

ENSMUST00000175726.8

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

4

Exon/intron indexes:

6,5,4,3

Exon/intron offsets:

0,11726,20143,30210

Genomic length:

31628

Exon/intron sizes in nt:

116,90,80,1418

Flanking exon/introns:

chr19:29698173-29700789|chr19:29732417-29763648

Splice length:

1704

Other database IDs:

circAtlas: mmu-9930021J03Rik_0014

Human Ortholog IDs:
Mature spliced Sequence:

GCTTCGGGAGCAAGAAAGAAAAGAAGCAGAAGAAGCTTGTCAAAAGGAAGTAGAAGAGTGGGAAAGAAAGCTCCTTGCTCAGGCAGCTCCAGCCTGCATGGAGAACATGTGGGAAATTCCAGCCATTGGCCATTTCCTTTGTTTAGCCCAACAGATTCTAAACTTGCCAGAAATTGTCTTTTATGAACTGGAGCGCTGTCTTCTGATGCCTCAGTGTAATGCCTTTCTCTCTAAAATAATGACTTCTCTACTAAGCCCTCCCCATCGCAGACCTACCTTACATCGAAGACCTACTTTGCCTTACAGGACTTGGGAAGCAGTGCTGAGACAGAAAGTGCAGCAGTGGTACACTGCTGTGGGACAGACTGAGAATCCTGATAACTGTGCTGAAAAGCTTGGCTTGTGTCCTCAGTTCTTTAAGGTTCTTGGAGAAGTTAATCCATTGGAAGAAAGACCTTTTCACGAGCTACCTTTCTACCAGAAAGTATGGCTGCTTAAAGGACTTTGTGACTTTGTGTATGAAACACAGAAAGAAGTTCAAGATGCTGTGCTTGGGCAGCCTATTCATGAGTGCAGGGAAGTTATCCTTGGTTATGATTATCTGGAGAATGCTTATGTACATTTTCCACAGTTCTGTGGTGCAGATGTGCGGATTTATAAACAAAGACCCTTTCAGGCCCCAGAATTTCCAGTTCCACCCATTAAAGTAAAAAGAGTACCTCGGATTAAACTGGAGAAATTCAAGTGTGACTATGCTAATACAAGTAACGGAGAACACAGATGTACTAAAGAAGGCCTGCCCTTGGCTTTCAAGAAAGAGCAAGAAATTGATTTTGATCCAGCCTGTTGTCCTACTAAAATGAACTTTGATAATCATGACATCACTCTTGAAATGGAAGTAAAATCCAACTGTGATATTAAAGTTCACAGGCCTTGTGAAATTGAAAAAACTGATTGTTGTAAAGAAAATTTGCAGAAACCCAGAAGTCCTGGAGAAGTTACTGGCTTTGGAGAGCCACTCAGTCCAGGTGAAATAAGATTTATAGAAAATCAGGAAAAATATGGTGAAGCTTCCAAAATAAAGACAGAATCCAATCCATTGAAAGAAAATGCTCTGAAATCTTGCCAAATTCATATAAATGGAAGTCACATTGATCATCCAGACATTAACTGCCACAAAGTTGTAAGGGATATATTGTTAGAGCACTCACTGCAAAGCCACAAGAAACTCAAGCTAACTAAAATGAGGGCAAAAAAGAAGAAAAAGAAAAAAAAGAAATTGAAAGATGTTTTGAATGAAAATTTACAAAGAAAGCGTGAAGGTCTTCATTCTCTTCCCTTCAAGTCTTACAAACCTGAGATCCAGAATAAATTATTGATCATCAAAAAGAAAGGAAAACACAAGAAGCACAAATCTGGAAAAAAATCCATATCTAAAAAAGCAATCACAAAGAAGAGGAAAACTGTCACAAAGTCACCTGCTGTGCCGGAATTTCAGCTTATTTGCACTAATCTTGATGAACTCAGGGAATTAATCACAAAAATCGAGAATGAACTCAAAGATCTGGAAAACAGTAGAAAAAAATCGGGCAAATGGTACCATCGGAGGCAAGCTGTAAAAGAATTACATAGTACACTAATACGCCTTTTAAATGAATTGCTACCATGGGAACCAAAGTTAATGAAGGCTTTTCAGAGAAACAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GGAGGCAAGCTGTAAAAGAA

55.95

GCAAGGAGCTTTCTTTCCCAC

59.73

178

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GGAGGCAAGCTGTAAAAGAA

55.95

GCAAGGAGCTTTCTTTCCCA

58.38

178

PCR template sequence:

GGAGGCAAGCTGTAAAAGAATTACATAGTACACTAATACGCCTTTTAAATGAATTGCTACCATGGGAACCAAAGTTAATGAAGGCTTTTCAGAGAAACAGGCTTCGGGAGCAAGAAAGAAAAGAAGCAGAAGAAGCTTGTCAAAAGGAAGTAGAAGAGTGGGAAAGAAAGCTCCTTGCTCAGGCAGCTCCAGCCTGCATG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

16

Interacting miRNAs (#binding sites)

mmu-miR-188-3p(2), mmu-miR-9-5p(1), mmu-miR-31-5p(1), mmu-miR-19b-3p(1), mmu-miR-19a-3p(1), mmu-miR-185-5p(1), mmu-miR-22-3p(1), mmu-miR-130b-3p(1), mmu-miR-721(1), mmu-miR-499-5p(1), mmu-miR-29b-2-5p(1), mmu-miR-207(1), mmu-miR-335-3p(1), mmu-miR-669d-5p(1), mmu-miR-350-3p(1), mmu-miR-670-5p(1)

siRNAs for circular RNA silencing
Junction sequence

TTCAGAGAAACAGGCTTCGGGAGCAA

siRNA sets

CTCCCGAAGCCTGTTTCTC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRC9930021J03RIK_1704_ORF_1

0.9748

-0.001615981

0.999999999

3309

ORF sequence:

ATGGAGAACATGTGGGAAATTCCAGCCATTGGCCATTTCCTTTGTTTAGCCCAACAGATTCTAAACTTGCCAGAAATTGTCTTTTATGAACTGGAGCGCTGTCTTCTGATGCCTCAGTGTAATGCCTTTCTCTCTAAAATAATGACTTCTCTACTAAGCCCTCCCCATCGCAGACCTACCTTACATCGAAGACCTACTTTGCCTTACAGGACTTGGGAAGCAGTGCTGAGACAGAAAGTGCAGCAGTGGTACACTGCTGTGGGACAGACTGAGAATCCTGATAACTGTGCTGAAAAGCTTGGCTTGTGTCCTCAGTTCTTTAAGGTTCTTGGAGAAGTTAATCCATTGGAAGAAAGACCTTTTCACGAGCTACCTTTCTACCAGAAAGTATGGCTGCTTAAAGGACTTTGTGACTTTGTGTATGAAACACAGAAAGAAGTTCAAGATGCTGTGCTTGGGCAGCCTATTCATGAGTGCAGGGAAGTTATCCTTGGTTATGATTATCTGGAGAATGCTTATGTACATTTTCCACAGTTCTGTGGTGCAGATGTGCGGATTTATAAACAAAGACCCTTTCAGGCCCCAGAATTTCCAGTTCCACCCATTAAAGTAAAAAGAGTACCTCGGATTAAACTGGAGAAATTCAAGTGTGACTATGCTAATACAAGTAACGGAGAACACAGATGTACTAAAGAAGGCCTGCCCTTGGCTTTCAAGAAAGAGCAAGAAATTGATTTTGATCCAGCCTGTTGTCCTACTAAAATGAACTTTGATAATCATGACATCACTCTTGAAATGGAAGTAAAATCCAACTGTGATATTAAAGTTCACAGGCCTTGTGAAATTGAAAAAACTGATTGTTGTAAAGAAAATTTGCAGAAACCCAGAAGTCCTGGAGAAGTTACTGGCTTTGGAGAGCCACTCAGTCCAGGTGAAATAAGATTTATAGAAAATCAGGAAAAATATGGTGAAGCTTCCAAAATAAAGACAGAATCCAATCCATTGAAAGAAAATGCTCTGAAATCTTGCCAAATTCATATAAATGGAAGTCACATTGATCATCCAGACATTAACTGCCACAAAGTTGTAAGGGATATATTGTTAGAGCACTCACTGCAAAGCCACAAGAAACTCAAGCTAACTAAAATGAGGGCAAAAAAGAAGAAAAAGAAAAAAAAGAAATTGAAAGATGTTTTGAATGAAAATTTACAAAGAAAGCGTGAAGGTCTTCATTCTCTTCCCTTCAAGTCTTACAAACCTGAGATCCAGAATAAATTATTGATCATCAAAAAGAAAGGAAAACACAAGAAGCACAAATCTGGAAAAAAATCCATATCTAAAAAAGCAATCACAAAGAAGAGGAAAACTGTCACAAAGTCACCTGCTGTGCCGGAATTTCAGCTTATTTGCACTAATCTTGATGAACTCAGGGAATTAATCACAAAAATCGAGAATGAACTCAAAGATCTGGAAAACAGTAGAAAAAAATCGGGCAAATGGTACCATCGGAGGCAAGCTGTAAAAGAATTACATAGTACACTAATACGCCTTTTAAATGAATTGCTACCATGGGAACCAAAGTTAATGAAGGCTTTTCAGAGAAACAGGCTTCGGGAGCAAGAAAGAAAAGAAGCAGAAGAAGCTTGTCAAAAGGAAGTAGAAGAGTGGGAAAGAAAGCTCCTTGCTCAGGCAGCTCCAGCCTGCATGGAGAACATGTGGGAAATTCCAGCCATTGGCCATTTCCTTTGTTTAGCCCAACAGATTCTAAACTTGCCAGAAATTGTCTTTTATGAACTGGAGCGCTGTCTTCTGATGCCTCAGTGTAATGCCTTTCTCTCTAAAATAATGACTTCTCTACTAAGCCCTCCCCATCGCAGACCTACCTTACATCGAAGACCTACTTTGCCTTACAGGACTTGGGAAGCAGTGCTGAGACAGAAAGTGCAGCAGTGGTACACTGCTGTGGGACAGACTGAGAATCCTGATAACTGTGCTGAAAAGCTTGGCTTGTGTCCTCAGTTCTTTAAGGTTCTTGGAGAAGTTAATCCATTGGAAGAAAGACCTTTTCACGAGCTACCTTTCTACCAGAAAGTATGGCTGCTTAAAGGACTTTGTGACTTTGTGTATGAAACACAGAAAGAAGTTCAAGATGCTGTGCTTGGGCAGCCTATTCATGAGTGCAGGGAAGTTATCCTTGGTTATGATTATCTGGAGAATGCTTATGTACATTTTCCACAGTTCTGTGGTGCAGATGTGCGGATTTATAAACAAAGACCCTTTCAGGCCCCAGAATTTCCAGTTCCACCCATTAAAGTAAAAAGAGTACCTCGGATTAAACTGGAGAAATTCAAGTGTGACTATGCTAATACAAGTAACGGAGAACACAGATGTACTAAAGAAGGCCTGCCCTTGGCTTTCAAGAAAGAGCAAGAAATTGATTTTGATCCAGCCTGTTGTCCTACTAAAATGAACTTTGATAATCATGACATCACTCTTGAAATGGAAGTAAAATCCAACTGTGATATTAAAGTTCACAGGCCTTGTGAAATTGAAAAAACTGATTGTTGTAAAGAAAATTTGCAGAAACCCAGAAGTCCTGGAGAAGTTACTGGCTTTGGAGAGCCACTCAGTCCAGGTGAAATAAGATTTATAGAAAATCAGGAAAAATATGGTGAAGCTTCCAAAATAAAGACAGAATCCAATCCATTGAAAGAAAATGCTCTGAAATCTTGCCAAATTCATATAAATGGAAGTCACATTGATCATCCAGACATTAACTGCCACAAAGTTGTAAGGGATATATTGTTAGAGCACTCACTGCAAAGCCACAAGAAACTCAAGCTAACTAAAATGAGGGCAAAAAAGAAGAAAAAGAAAAAAAAGAAATTGAAAGATGTTTTGAATGAAAATTTACAAAGAAAGCGTGAAGGTCTTCATTCTCTTCCCTTCAAGTCTTACAAACCTGAGATCCAGAATAAATTATTGATCATCAAAAAGAAAGGAAAACACAAGAAGCACAAATCTGGAAAAAAATCCATATCTAAAAAAGCAATCACAAAGAAGAGGAAAACTGTCACAAAGTCACCTGCTGTGCCGGAATTTCAGCTTATTTGCACTAATCTTGATGAACTCAGGGAATTAATCACAAAAATCGAGAATGAACTCAAAGATCTGGAAAACAGTAGAAAAAAATCGGGCAAATGGTACCATCGGAGGCAAGCTGTAAAAGAATTACATAGTACACTAATACGCCTTTTAAATGAATTGCTACCATGGGAACCAAAGTTAATGAAGGCTTTTCAGAGAAAC

Peptide sequence:

MENMWEIPAIGHFLCLAQQILNLPEIVFYELERCLLMPQCNAFLSKIMTSLLSPPHRRPTLHRRPTLPYRTWEAVLRQKVQQWYTAVGQTENPDNCAEKLGLCPQFFKVLGEVNPLEERPFHELPFYQKVWLLKGLCDFVYETQKEVQDAVLGQPIHECREVILGYDYLENAYVHFPQFCGADVRIYKQRPFQAPEFPVPPIKVKRVPRIKLEKFKCDYANTSNGEHRCTKEGLPLAFKKEQEIDFDPACCPTKMNFDNHDITLEMEVKSNCDIKVHRPCEIEKTDCCKENLQKPRSPGEVTGFGEPLSPGEIRFIENQEKYGEASKIKTESNPLKENALKSCQIHINGSHIDHPDINCHKVVRDILLEHSLQSHKKLKLTKMRAKKKKKKKKKLKDVLNENLQRKREGLHSLPFKSYKPEIQNKLLIIKKKGKHKKHKSGKKSISKKAITKKRKTVTKSPAVPEFQLICTNLDELRELITKIENELKDLENSRKKSGKWYHRRQAVKELHSTLIRLLNELLPWEPKLMKAFQRNRLREQERKEAEEACQKEVEEWERKLLAQAAPACMENMWEIPAIGHFLCLAQQILNLPEIVFYELERCLLMPQCNAFLSKIMTSLLSPPHRRPTLHRRPTLPYRTWEAVLRQKVQQWYTAVGQTENPDNCAEKLGLCPQFFKVLGEVNPLEERPFHELPFYQKVWLLKGLCDFVYETQKEVQDAVLGQPIHECREVILGYDYLENAYVHFPQFCGADVRIYKQRPFQAPEFPVPPIKVKRVPRIKLEKFKCDYANTSNGEHRCTKEGLPLAFKKEQEIDFDPACCPTKMNFDNHDITLEMEVKSNCDIKVHRPCEIEKTDCCKENLQKPRSPGEVTGFGEPLSPGEIRFIENQEKYGEASKIKTESNPLKENALKSCQIHINGSHIDHPDINCHKVVRDILLEHSLQSHKKLKLTKMRAKKKKKKKKKLKDVLNENLQRKREGLHSLPFKSYKPEIQNKLLIIKKKGKHKKHKSGKKSISKKAITKKRKTVTKSPAVPEFQLICTNLDELRELITKIENELKDLENSRKKSGKWYHRRQAVKELHSTLIRLLNELLPWEPKLMKAFQRN

IRESfinder result

IRESfinder score

0.681125269

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page