top of page

mmu_circ4932438A13Rik_998

Basic information of circular RNA
PanCircBase ID:

mmu_circ4932438A13Rik_998

mm39_Chr. Position ID:

chr3|37058987|37067159|+

Gene name:

4932438A13Rik

Transcript:

ENSMUST00000057272.15

CircRNA type:

Exonic circular (circ)RNA

Exon/Intron count:

6

Exon/intron indexes:

57,58,59,60,61,62

Exon/intron offsets:

0,2146,3555,6106,6729,8041

Genomic length:

8172

Exon/intron sizes in nt:

16,92,12,19,96,02,27,100

Flanking exon/introns:

chr3:37058083-37058987|chr3:37067159-37068553

Splice length:

998

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTTTATGAAGAAGCTGGTTCTGATTTTCATCAAGTTGCCTATTTTAAAACTAGAATTGGACTAAGGAACGCCCTTCGAGAGGAAATCAGTGGTTCTTCAGATAGGGAAGCTGTGCTTATTACTCTGAATAGACCAATTGTTTATGCACAACCTGTGGCTTTTGATAGAGCTGTTCTGTTTTGGCTGAATTATAAAGCTGCCTATGACAACTGGAATGAACAACGAATGGCTTTACATAAGGATATTCATATGGCTACAAAGGAAGTGGTAGACATGCTCCCTGGTATCCAGCAGACATCAGCCCAGGCCTTTGGGACTCTCTTCCTCCAGCTAACTGTGAATGATCTAGGAATTTGCCTCCCTATAACAAATACCGCACAGTCTAACCACACTGGAGACCTGGACACTGGCTCTGCTCTAGTGCTGACCATTGAAAGTACTCTCATCACTGCATGCTCCTCAGAGTCTCTGGTTAGCAAAGGCCATTTCAAGAACTTTTGTATCCGTTTTGCTGATGGCTTTGAGACATCATGGGATGACTGGAAACCAGAAATCCGTGGAGATCTAGTAATGAATGCTTGTGTAGTTCCAGATGGTACCTACGAGGTTTGTTCAAGGACTACAGGACAAGCTGCAGCTGAAAGTAGTAGTGCCGGAACCTGGACACTGAATGTATTGTGGAAAATGTGTGGGATTGATGTCCACATGGACCCTAACATTGGCAAAAGGCTTAATGCTCTGGGCAACACCCTTACAACACTGACAGGAGAGGAAGACATAGATGACATTGCTGACCTCAATTCAGTGAACATAGCTGACTTGTCAGATGAAGATGAAGTCGATACCATGTCTCCTACAATCCATACTGAAGCTGTAGATTATCGAAGACAAGGAACATCTTCTAGTCAGCCAGGAGAACTGAGAGGAAGGAAGATTATGAAGCGCTTAGTGGACATCAGAGAACTGAATGAACAGGCCAAAGTAATAGATGACCTTAA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GCGCTTAGTGGACATCAGAGA

59.86

TTTCCTCTCGAAGGGCGTTC

60.04

142

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

AGCGCTTAGTGGACATCAGAG

59.86

TTTCCTCTCGAAGGGCGTTC

60.04

143

PCR template sequence:

CTTCTAGTCAGCCAGGAGAACTGAGAGGAAGGAAGATTATGAAGCGCTTAGTGGACATCAGAGAACTGAATGAACAGGCCAAAGTAATAGATGACCTTAAGTTTATGAAGAAGCTGGTTCTGATTTTCATCAAGTTGCCTATTTTAAAACTAGAATTGGACTAAGGAACGCCCTTCGAGAGGAAATCAGTGGTTCTTCAG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

6

Interacting miRNAs (#binding sites)

mmu-miR-199a-5p(1), mmu-miR-181b-5p(1), mmu-miR-495-3p(1), mmu-miR-384-3p(1), mmu-miR-29b-2-5p(1), mmu-miR-181d-5p(1)

siRNAs for circular RNA silencing
Junction sequence

TAGATGACCTTAAGTTTATGAAGAAG

siRNA sets

CTTCTTCATAAACTTAAGG, TTCTTCATAAACTTAAGGT, TCTTCATAAACTTAAGGTC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CIRC4932438A13RIK_998_ORF_1

1.0346

0.163305505

0.965841306

837

ORF sequence:

ATGGCTTTACATAAGGATATTCATATGGCTACAAAGGAAGTGGTAGACATGCTCCCTGGTATCCAGCAGACATCAGCCCAGGCCTTTGGGACTCTCTTCCTCCAGCTAACTGTGAATGATCTAGGAATTTGCCTCCCTATAACAAATACCGCACAGTCTAACCACACTGGAGACCTGGACACTGGCTCTGCTCTAGTGCTGACCATTGAAAGTACTCTCATCACTGCATGCTCCTCAGAGTCTCTGGTTAGCAAAGGCCATTTCAAGAACTTTTGTATCCGTTTTGCTGATGGCTTTGAGACATCATGGGATGACTGGAAACCAGAAATCCGTGGAGATCTAGTAATGAATGCTTGTGTAGTTCCAGATGGTACCTACGAGGTTTGTTCAAGGACTACAGGACAAGCTGCAGCTGAAAGTAGTAGTGCCGGAACCTGGACACTGAATGTATTGTGGAAAATGTGTGGGATTGATGTCCACATGGACCCTAACATTGGCAAAAGGCTTAATGCTCTGGGCAACACCCTTACAACACTGACAGGAGAGGAAGACATAGATGACATTGCTGACCTCAATTCAGTGAACATAGCTGACTTGTCAGATGAAGATGAAGTCGATACCATGTCTCCTACAATCCATACTGAAGCTGTAGATTATCGAAGACAAGGAACATCTTCTAGTCAGCCAGGAGAACTGAGAGGAAGGAAGATTATGAAGCGCTTAGTGGACATCAGAGAACTGAATGAACAGGCCAAAGTAATAGATGACCTTAAGTTTATGAAGAAGCTGGTTCTGATTTTCATCAAGTTGCCTATTTTAAAACTAGAATTGGACTAA

Peptide sequence:

MALHKDIHMATKEVVDMLPGIQQTSAQAFGTLFLQLTVNDLGICLPITNTAQSNHTGDLDTGSALVLTIESTLITACSSESLVSKGHFKNFCIRFADGFETSWDDWKPEIRGDLVMNACVVPDGTYEVCSRTTGQAAAESSSAGTWTLNVLWKMCGIDVHMDPNIGKRLNALGNTLTTLTGEEDIDDIADLNSVNIADLSDEDEVDTMSPTIHTEAVDYRRQGTSSSQPGELRGRKIMKRLVDIRELNEQAKVIDDLKFMKKLVLIFIKLPILKLELD

IRESfinder result

IRESfinder score

0.499851886

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page