top of page

mmu_ciPitrm1_2257

Basic information of circular RNA
PanCircBase ID:

mmu_ciPitrm1_2257

mm39_Chr. Position ID:

chr13|6625165|6627422|+

Gene name:

Pitrm1

Transcript:

ENSMUST00000021611.10

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

22

Exon/intron offsets:

0

Genomic length:

2257

Exon/intron sizes in nt:

2257

Flanking exon/introns:

chr13:6625165-6627425

Splice length:

2257

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAGGAAAGGGGGCGGGGAAAGTGCACCTCCCTCTCACAGCTGGACTTGAGTGAAATTGTTTGTCCAGCATGATAGAAGGCAGAAAGGGGACAGGTAGGAGAGATGGCTCTGTTGGTAAAGTGCTTATCATGCAAGTACGAGAACCTAAGTTGAGACCCCCGTTACCCCTCAGAAAAGCCAGATGTCCTGCATCTGTAACCCCCGTGCCACAGAGGAAAAGATAGGCAGACATCTGGAGCGCATTGACCAGTGTAGCCAAATCAGCATACTGCAAGTTCAGTTAGAAACCCTATCTCCAGAAATAAAGACCATTCTGTCTGAAGAATGGCCGTGGTAGCTGAACTTTCTCTCCCAATTGAATGAGCTTTCTTAGTAGCATATGCCAATTAAAGATAAAAGAGCGAAGAGAAGCAGCTGACAGCAGAATATCAAATCCTGCACTGACAACAGTATCCAGAGGTGACTAGATATGTACCGTGGAAGCTGTCAGCTGCAGTCCAGGGTCAGTCTTAGCCGTGTTTTCCCCTTGGGTGAGCCTTCTGGTTTCTGGAAATGGCTTGCCTTCCAGCTGTTCTTGGGGCACACTCTTTGTCATATCCCTTGGGCTCTTTTCTTTTCCCCTTGTCACAGGGCCAGGGGGCCAGCCTACCCCAGGACATAAGGTCTTCAAGGACACTTGAATACTCTTGAGTCTGAGGCAAGGGAACCCACCCTGGATACGAAGTGAGCTCTAAGCAAGCACAACCAGCACGTAACAATTTACTGATATGATTTATAATACAGAGAATAAGGAGAGAAGATACCATTGATTTCTGGACACACACACACACACACACACAGGTCTGCATGTGAGTGCTATAGAGGGCACAGGAGATGCTTTGTACACAGAAAGTTTCCGCACCAGCTTTGCACACTGGACGGACACTGTGTTACATTGTACCAGTCTGTCATCTGCATGCTCTGACCATACCGCTCAGCGAGCGCTCGTGTGCAGAATAAAGCACAGCCCACCAGTAGTCTATAAATGGCACCTTTATGAATAAGATGCCCAGTATTGTGTGCAGTTGTTTTTCTAAAGGATTTATTTTACTATGTATGGATTCAGTGTTCTGCCTGCAGGTACATGTGCATGCCAGAAGAGGGCACCAGCTCTCAGTATAGCAGGTTATAAAACACCATGTGGTTGGCTGGGAGTTGAACTCAGAACTGCTAGACCTATGGAGGAGTAGCCAGTACTCCTAATCTCTGAGCCATCTCTCCAACCCCTGTACACAGTTATTTTTGTGAATTATTTCTATCCCTCAGCAGTCCTGTGTGCAACACCATAGATACTTATGCCCCTAAGTGCAAATGTCCTTCAAAGAAATCACTTACTCCTCCTCATCTGTATTTAACAATTGTGTAAATAAATCTTAAACTGATTGATAAATGTAGAATGAACCCACATGCTTGCATATGACACACACACATGGATGCGTGTGCTAACGCACATGTGCGCACCCAAACACACACACACACACACACCTTTGTCCCTGCTGTGACAAGACACCCGACAGAAACGACTGCAGAAGGGAGGGGTTTATTCTGGTTCACAGTAGGCTGCTACAGTCTATCAGAATGAGGAAGCCATGGCAGGATCATGAAACCACACATAGTGTGTCTACAGGCAGGGAGCGGACAGCAATTACTGCTGGTGCTCAGTTCACACTCCCCGTTGTATACATATAGTCTGGGACCTCATCTCATGGGATGGCACTGCCCACATTGAGGTCTAGAAACTCCTTCCCAGATGTGCCCGTCAGGTTGACAGTCTGTTAGCCATTCTGGATGGGGTGGTGTGCATCTTGTGAGAACTGCGGCAGCATTTTGAAAGCGGCAGATAGAGGCACATGGACCGTGTACCCCAGGGGTTCTGTGGAGGGACAGACCCACAAGGAGGACAGACTGTACTGCCCTGAGGCAGCAGCCAACTAGATGGGTGAATCTCTGAGAGCAAGATCTGGAAACACGAACCATTCCAGGTTCCTCGGAGGAGCAGTTGGACTCCATGCTCTGCCACCTCAGGATCTTACAAAGTCCCTGTGTGATGGAGAGGAAGTCAGAATGCTTGGAAGAGGGCCAGCTGTACACAACCTTACACCTTAGCTGGACTTTAGCTTCTTTTCCAGCTCTGCGCCCCATCTCTAGGCTTTGGTTTTTATAGTCGGCTTCCTGGGAGCCATGCTCTCTCTAACTTGTCTTTTGTTCCCTTCATTT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

CTTCTTTTCCAGCTCTGCGC

59.83

CAAGTCCAGCTGTGAGAGGG

60.04

149

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

CTTCTTTTCCAGCTCTGCGC

59.83

AAGTCCAGCTGTGAGAGGGA

60.18

148

PCR template sequence:

CTTCTTTTCCAGCTCTGCGCCCCATCTCTAGGCTTTGGTTTTTATAGTCGGCTTCCTGGGAGCCATGCTCTCTCTAACTTGTCTTTTGTTCCCTTCATTTGTAGGAAAGGGGGCGGGGAAAGTGCACCTCCCTCTCACAGCTGGACTTGAGTGAAATTGTTTGTCCAGCATGATAGAAGGCAGAAAGGGGACAGGTAGGA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

30

Interacting miRNAs (#binding sites)

mmu-miR-1187(4), mmu-miR-466a-5p(2), mmu-miR-466p-5p(2), mmu-miR-574-5p(2), mmu-miR-210-3p(1), mmu-miR-199a-5p(1), mmu-miR-135a-5p(1), mmu-miR-34c-5p(1), mmu-miR-19b-3p(1), mmu-miR-122-5p(1), mmu-miR-29b-3p(1), mmu-miR-29a-3p(1), mmu-miR-29c-3p(1), mmu-miR-19a-3p(1), mmu-miR-328-3p(1), mmu-miR-320-3p(1), mmu-miR-138-5p(1), mmu-miR-185-5p(1), mmu-miR-214-3p(1), mmu-miR-411-3p(1), mmu-miR-218-5p(1), mmu-miR-382-5p(1), mmu-miR-34b-5p(1), mmu-miR-297a-5p(1), mmu-miR-666-5p(1), mmu-miR-29b-2-5p(1), mmu-miR-377-3p(1), mmu-miR-669d-5p(1), mmu-miR-490-3p(1), mmu-miR-296-3p(1)

siRNAs for circular RNA silencing
Junction sequence

GTTCCCTTCATTTGTAGGAAAGGGGG

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.64063153

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page