top of page

mmu_ciPhc1_1774

Basic information of circular RNA
PanCircBase ID:

mmu_ciPhc1_1774

mm39_Chr. Position ID:

chr6|122312042|122313816|-

Gene name:

Phc1

Transcript:

ENSMUST00000079560.10

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

1

Exon/intron offsets:

0

Genomic length:

1774

Exon/intron sizes in nt:

1774

Flanking exon/introns:

chr6:122312042-122313816

Splice length:

1774

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTGAGGCTCAGCTGAGTGGCCGAGCTCTGTGAGTATTGACGTGGGTTAGGCAAAGGTAGCAGAGGATCCTCATCCTCGGATTCTTTCCGAGTAGGTCCACTTCAGAGTCTTAGCAGTTTACAGAGTTAGAGCAAGCAAACCCAGAGTGAAATTTGCTCATTTTGTTTTAGCTTTTAGCAATGTACCAAGTTCAAGGCCAGCTTGGGCAACTTGGTGAGAACCTGTCTTGAAATAAAACTACAAAAAGATAGAGTTGAAGAGTGCAGTTCATTGATTCAATATGAAATACTATAAAGTTCACACATGAATAAATAAATAAGGTTCAGGGTATTAATTAGATTTTAATTAACCATTTCTTTTCATTGTTTAAAAATATCTACTTACTATTTGTGCACACACGCACTTGTGTGTATGTGCGTGCACACGTGCGTGCGTATGCATGTGTGTGTACAGTGCTGTGTATGTGGAGGTCAGAGGACACAAATGAGTTTATGCTGTGCAGTATATACAGGTGCCGTTGGCTCTTGAGCTTCTGGTCACTTCTGTCTCCATCTGCCATGTCATAAAGAGTGCTGGGATTGCAGATATGCACCACTGCACCTGACCTGTTGTTGAAGTTGTTCTGAGACCTGAGCTCTGGTCCTCGGGCTGTGCTACAGGTGCTCTTCCCACACAGCTCCCTTTCCTGCCTCAGTAGTCAAGTGTTCAATTTTGGGCCTTATACATTATTCTGTGTAGTAGAAGTATCAATGACCTTTTTAGACATTTGCTTTTGAACAAATAGCAAATTTTATACCTTAAATATCCTGTTTGGAAATGAAACATTTTTCTTTTTTTTTTTTTTTTAAAGATTTATTTATTATTATATATAAGTACCCTGTAACTGTCTTCAGACACACCAGAAGAGGGCATCAGATCTCATTACAGATAGTTGTGAGCTACCATGTGGTTGCTGGGATTTGAACTCAGGACCTTCAGAAGAGCAGTCAATGCTCTTACCCGCTGAGCCATCTCTCCAGCCCCCTGAAGTATTTTTCTTAAAAGACTTTGGTGGAATGGTTGTAATTATTAAAGAATAAGAACATAGGAAAATCTAGTTGACACTAAAACGATCACTGTCAGCTTTATAAATAGCCATTGACATTTTACAGTAGATATTTGGAAGTGTCAATCGCTTGAGAGTTTTGCCTGGTAGAATTGTTCAGAAGTCACTACTGTTTTTCTTGGTAGAATTGTTCAGACTGTGTTTCTGTCATCTATCTCTAAATACTTAAGGATCTGTATCTGGATGCTAGATACCTATGGTATATAGCTCTTTCCTTTTATTTGTTTGTATATTTAATTATTTATTTGAGACATGGCTTACTCTGTTAGCCTGGCTGGCCTGGGACTCATCATTTTCCTGCTTCCATTTTTCAAGTGCTGGGATTATAGGCATTTGCCTCCATGTCTAGCTTCTTTTCCTTATATTAGTAAGCATCCCATTTATTTGTAGTTTGTCTAGATCTTGTGATATATATAAGGTCTTATTTTGAGAAGTTCATATTCACTGGTTTGCTTTTCTTTATATGTGAGGAGAGACCATAGAATCAGTTGTCTCTGCTGTTTTAGATGGCTGAGTAGACTACTGAATCCAACATTGTAAGGACAAATCAGATGCTGTGATAGTCGTCCTTTGTCTCCTATTGTTCCTCTCCTTCCTGACTCCCTTCGCAACAGTGACGCACATGGGAGTTAGGAGTGATGGTTCTGAGTACTGTCTCCTGTCTTCTAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TCCTCTCCTTCCTGACTCCC

59.66

CCTTTGCCTAACCCACGTCA

60.25

141

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TCCTCTCCTTCCTGACTCCC

59.66

ACCTTTGCCTAACCCACGTC

60.25

142

PCR template sequence:

TTTGTCTCCTATTGTTCCTCTCCTTCCTGACTCCCTTCGCAACAGTGACGCACATGGGAGTTAGGAGTGATGGTTCTGAGTACTGTCTCCTGTCTTCTAGGTGAGGCTCAGCTGAGTGGCCGAGCTCTGTGAGTATTGACGTGGGTTAGGCAAAGGTAGCAGAGGATCCTCATCCTCGGATTCTTTCCGAGTAGGTCCAC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

12

Interacting miRNAs (#binding sites)

mmu-miR-340-5p(2), mmu-miR-335-5p(1), mmu-miR-709(1), mmu-miR-326-3p(1), mmu-miR-199b-3p(1), mmu-miR-199a-3p(1), mmu-miR-499-5p(1), mmu-miR-466a-5p(1), mmu-miR-1187(1), mmu-miR-466p-5p(1), mmu-miR-673-5p(1), mmu-miR-344-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TCCTGTCTTCTAGGTGAGGCTCAGCT

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.896839681

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page