top of page

mmu_ciPdgfa_88

Basic information of circular RNA
PanCircBase ID:

mmu_ciPdgfa_88

mm39_Chr. Position ID:

chr5|138982776|138982864|-

Gene name:

Pdgfa

Transcript:

ENSMUST00000110896.2

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

1

Exon/intron offsets:

0

Genomic length:

88

Exon/intron sizes in nt:

88

Flanking exon/introns:

chr5:138982151-138982864

Splice length:

88

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTGGGGCGCTTCTCAACGTTTTCCATACTCCCTCTTTAGGCCAAGAGAGGGTGTCCTCTTATCTCCTGAGCATCCCGAGGTGTTAGGG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GAGCATCCCGAGGTGTTAGG

59.89

TGGCCTAAAGAGGGAGTATGGA

60.02

64

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GAGCATCCCGAGGTGTTAGG

59.89

TGGCCTAAAGAGGGAGTATGG

58.59

64

PCR template sequence:

GAGAGGGTGTCCTCTTATCTCCTGAGCATCCCGAGGTGTTAGGGGTGGGGCGCTTCTCAACGTTTTCCATACTCCCTCTTTAGGCCAA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

NA

Interacting miRNAs (#binding sites)

NA

siRNAs for circular RNA silencing
Junction sequence

CGAGGTGTTAGGGGTGGGGCGCTTCT

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.744513129

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page