top of page

mmu_ciPan2_1209

Basic information of circular RNA
PanCircBase ID:

mmu_ciPan2_1209

mm39_Chr. Position ID:

chr10|128154907|128156116|+

Gene name:

Pan2

Transcript:

ENSMUST00000005825.8

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

24

Exon/intron offsets:

0

Genomic length:

1209

Exon/intron sizes in nt:

1209

Flanking exon/introns:

chr10:128154907-128156116

Splice length:

1209

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTGAGTTGCTCTACCTTGTGCGCCCTACAGTAAGAACTGATTACAAGCAGAAAACATTCAGGGTGGAGACAGGGTAGATGGCTCAGAGGTGCTTGCTTGTTTCTTGTTTGGGGTTTTGTTTTTGTTTTTGTTTTGACACAGTGTCTCACTAAGTAGCTCTGGCTGCCCTGTAACTAGTTATGTTGAGCACTGGCTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGGGATCCCATGCCCTCTTCTGGTGCGTCTGAAGAGAGAGACAGTGTTTTACTCACATAAAACAAACAAATAAATCTTAAAAGAAAACATCAGGGGCAGGGGATACAGCTCAGCTGGTAGAGTCCTTGTTGAGAGCTCAGCACCACATGGAAGTGGACACAGGCGGCAGGCCTGCCTAGAGTCACAACTCAGGAGACACAGAAGAAACAGAACTTTAAGGTTAGTCTCAGTACATAATGAGTTCAAGGCCAGCCTGGGCTACAAAAGGCCATTTTTGCTTTTAAAAAGGAGAGTAGAAAGCACCAGGAGGCGACACTTTCAGGTCTGTAAGTTTGAAGCCAGTCTGGGCAGTAGAGGAGATACTGTCTTAACAACGATAGCAAAAAGCTACAACAATCTCTCAGGAGGCAGAGGCAGGTGGATGTCTGAATTCGAGGCCAGTCTGGTCTACAGTCTCAGTTCCAGGACAGCCAGGGCTACACAAAGAAACCCTGTCTTCAAACAAACAAAAAATCTACAAGAACAACAAAACAGGAATCATTTTAGAATAAAGAATAGTTATTTCTCAAGTTAGAATTACCATTTTTTTCAGCTAATGGTTTTAGTTAGATCTATCACTAATTTAAGAAGACGTTTTCTGGGTCTGACGAGTTGGCTTAGAGCACCTACCACTGCTCTTGCAGAGGGCCCAGGATCAAGCCCCAGTGCTTAACATGATAGCTCACAACCGCTCACAACCGTGTGTAACCTCAGTTCAGGCAATCTGACACCATCTTTTGACCTTCATGGTCACCATGCACACCCATACATAGACCACGCAGGCAAAACAGTCAGTAAACATAAAATAAGAAAAGATGTTTCTAGGAGACTGCGTGGGAGTGTTGTGGGTGCCAGGATAGAGATGGGGTGCCTGCCGCCTTTGTGAGTTCCTTAAGTATCGGTGTACCCCAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GTGTTGTGGGTGCCAGGATA

59.96

CTACCCTGTCTCCACCCTGA

59.96

150

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GTGTTGTGGGTGCCAGGATA

59.96

TCTACCCTGTCTCCACCCTG

59.96

151

PCR template sequence:

AAGATGTTTCTAGGAGACTGCGTGGGAGTGTTGTGGGTGCCAGGATAGAGATGGGGTGCCTGCCGCCTTTGTGAGTTCCTTAAGTATCGGTGTACCCCAGGTGAGTTGCTCTACCTTGTGCGCCCTACAGTAAGAACTGATTACAAGCAGAAAACATTCAGGGTGGAGACAGGGTAGATGGCTCAGAGGTGCTTGCTTGT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

11

Interacting miRNAs (#binding sites)

mmu-miR-5101(2), mmu-miR-200a-3p(1), mmu-miR-141-3p(1), mmu-miR-199a-5p(1), mmu-miR-339-5p(1), mmu-miR-10a-5p(1), mmu-miR-1187(1), mmu-miR-539-5p(1), mmu-miR-452-3p(1), mmu-miR-350-3p(1), mmu-miR-344-3p(1)

siRNAs for circular RNA silencing
Junction sequence

CGGTGTACCCCAGGTGAGTTGCTCTA

siRNA sets

TAGAGCAACTCACCTGGGG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.741296333

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page