top of page

mmu_ciNup205_746

Basic information of circular RNA
PanCircBase ID:

mmu_ciNup205_746

mm39_Chr. Position ID:

chr6|35209524|35210270|+

Gene name:

Nup205

Transcript:

ENSMUST00000201374.4

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

32

Exon/intron offsets:

0

Genomic length:

746

Exon/intron sizes in nt:

746

Flanking exon/introns:

chr6:35209524-35210270

Splice length:

746

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGGTTGTGTGGATGCTGGACTTTATAGGCCAGTAGGTCTTCTCCTGGTCCTGCAGCTGTGCTTACTGCTAGCTCGGCCACTGGTGTTCCCTGAGCATTTCTGTTATATAAGCTGCCATTATGTTAAGTTTTACATTTGGGGATTTGTGCTAACAGTGCAGCTTTCAGTATAAAGATGGGCTGCAATGATCCTGAGAAGGTTAGAGGGCAGTGTCCTGCTGCCAGCTTGCTCACTGAGGAGGATGTTGAGGTGGCATGATGCCAGGGTTCGTGGGAAGGGAACAGTGCCTTAAGTACTCTTGTCTTTGTCATTTCCTTCCGTCCAGATCTGCTGCAGTCTCTCCATGTTAAATTTCTTACATAATGTCACACTAGTGGAAGTCTTAGACTCGCCATCCATTTATTCATACGTATTTACTAAATACCTAATATACACCAAGCATGATGCTACACACACTAGAAATGGGCACAGCAAACCCACCGTTGACCTGTTGACAGAAACTATATTTGAATTGAATAATTTGCAGTAATAATAATGTGCAATACTCAGGCACTTTGCACCCCCCTCAACCAGAGTTCTCATAAAAATGTTATGAAAAAAGAGGTACAATGTGTCCTTGTAGCTAGGTCAGGATTTTCCCCTCACTAGTGATTAATAAGGAATGAACTAAGAGTGTCTTGTTTCCTCATAAGCCCCTTGGACATGATTTCAGCACTGATACTTTCCCTTTTGTATCTTTGTAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

CCTCATAAGCCCCTTGGACA

59.08

ATGCTCAGGGAACACCAGTG

59.96

160

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TCCTCATAAGCCCCTTGGAC

58.79

ATGCTCAGGGAACACCAGTG

59.96

161

PCR template sequence:

ACTAGTGATTAATAAGGAATGAACTAAGAGTGTCTTGTTTCCTCATAAGCCCCTTGGACATGATTTCAGCACTGATACTTTCCCTTTTGTATCTTTGTAGGTAAGGTTGTGTGGATGCTGGACTTTATAGGCCAGTAGGTCTTCTCCTGGTCCTGCAGCTGTGCTTACTGCTAGCTCGGCCACTGGTGTTCCCTGAGCAT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

18

Interacting miRNAs (#binding sites)

mmu-miR-20b-5p(1), mmu-miR-106a-5p(1), mmu-miR-93-5p(1), mmu-miR-20a-5p(1), mmu-miR-17-5p(1), mmu-miR-32-5p(1), mmu-miR-106b-5p(1), mmu-miR-184-3p(1), mmu-miR-203-3p(1), mmu-miR-320-3p(1), mmu-miR-185-5p(1), mmu-miR-214-3p(1), mmu-miR-363-3p(1), mmu-miR-342-5p(1), mmu-miR-499-5p(1), mmu-miR-410-3p(1), mmu-miR-193b-3p(1), mmu-miR-338-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TGTATCTTTGTAGGTAAGGTTGTGTG

siRNA sets

ACAACCTTACCTACAAAGA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.737207552

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page