top of page

mmu_ciNktr_442

Basic information of circular RNA
PanCircBase ID:

mmu_ciNktr_442

mm39_Chr. Position ID:

chr9|121570217|121570659|+

Gene name:

Nktr

Transcript:

ENSMUST00000183070.8

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

9

Exon/intron offsets:

0

Genomic length:

442

Exon/intron sizes in nt:

442

Flanking exon/introns:

chr9:121570217-121570663

Splice length:

442

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGCATCGGTTTGTTAAAATCTCAGAGAATTGTTTGATGAGCCCGAAAGACTTGCTGGCCTGGGTTAGTCTTTTGTAGCCAAGCTCTTCCCAAAGGGGCACAGGGTATAGGAGTTTGAGAGCCTGACTCATTTTTGCCCATGAGTTTTGCATATACTTGTTGAGATGAATTCTCAGTATGAAGTGTCCTCTCTTAGCAGATTCTTAACCCTAAAATGGCCAGCAGCTGTTGACAGCAGAGACTGCGTCCCACCTTGTCTTGAGATGAGCTGTCACTACTTCCTGTTAGGAAGTAGATTTCAAGTTGTCATTCCCTTATAATTGGTTCATAACACTTTGGTTTGTTTGTAGTTGTGTGGATAGTTTTTGATACCCGTTGTCCCAATTATGTTCATACTGTAATTATTACCAGACTAATTCATTCCTTGGATTTATATTATG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GTTTTTGATACCCGTTGTCCCA

59.11

AAAGACTAACCCAGGCCAGC

59.96

154

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

ACCCGTTGTCCCAATTATGT

57.11

AAAGACTAACCCAGGCCAGC

59.96

145

PCR template sequence:

TTGTTTGTAGTTGTGTGGATAGTTTTTGATACCCGTTGTCCCAATTATGTTCATACTGTAATTATTACCAGACTAATTCATTCCTTGGATTTATATTATGGTAAGCATCGGTTTGTTAAAATCTCAGAGAATTGTTTGATGAGCCCGAAAGACTTGCTGGCCTGGGTTAGTCTTTTGTAGCCAAGCTCTTCCCAAAGGGG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

4

Interacting miRNAs (#binding sites)

mmu-miR-19b-3p(1), mmu-miR-19a-3p(1), mmu-miR-495-3p(1), mmu-miR-452-3p(1)

siRNAs for circular RNA silencing
Junction sequence

GATTTATATTATGGTAAGCATCGGTT

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.893090294

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page