top of page

mmu_ciNaa35_634

Basic information of circular RNA
PanCircBase ID:

mmu_ciNaa35_634

mm39_Chr. Position ID:

chr13|59756658|59757292|+

Gene name:

Naa35

Transcript:

ENSMUST00000022038.15

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

10

Exon/intron offsets:

0

Genomic length:

634

Exon/intron sizes in nt:

634

Flanking exon/introns:

chr13:59756658-59757292

Splice length:

634

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTGAGAGAATTGCTGTAACTGGGTCAGAGGTAGACGGCATGTCCTTCCTGTCCTCACGCTTCTCTGTATACTTAAATGCTTTTGTGAAACGTGATTATAGCTCTAGATCTATTTTATAACACACTGAGGTCTCTTGTGGATAGATTAAAAACTGTTTCAAGTAATTCTTTTTTCTTGGATTCCCTCTTCCCCCATATTTGTGAATAACTGTAGATTATTGGAACTTTTCCCTTTTTATATTTGACTGTATGTTCAATTTTTTTCTTTAGTTTTTTGTTTGTTTTTTGTTTTTTTGTTTTTTGAGACAAGGTTTCTCTGGCCTGGAGCTCATTCTGTAGACCAGGCTGGACTCAAACTCAGATTTCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGCGCCACCACGCCCAGCTATCTTTTTTTTTTTTTTTAACACATCAAATAAGATACGGATTTGAGGGGAACCTTTGTCTCCTGTTGAGGATTTGAGCATCCTGCGGTGCTGCATTAAGTGAACAATGTGTGAGGATCCGTGCATGCTTTGGATCTTAGTACTGTTGTAGGATCTCCTCTTGTACGTGTATCTTTCAGTGAAAGTGTGTAAGTGTTTTGGTGATTTGTTTGCTAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TCCGTGCATGCTTTGGATCT

60.04

AGGACATGCCGTCTACCTCT

60.03

144

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TCCGTGCATGCTTTGGATCT

60.04

CATGCCGTCTACCTCTGACC

59.9

140

PCR template sequence:

ATCCGTGCATGCTTTGGATCTTAGTACTGTTGTAGGATCTCCTCTTGTACGTGTATCTTTCAGTGAAAGTGTGTAAGTGTTTTGGTGATTTGTTTGCTAGGTGAGAGAATTGCTGTAACTGGGTCAGAGGTAGACGGCATGTCCTTCCTGTCCTCACGCTTCTCTGTATACTTAAATGCTTTTGTGAAACGTGATTATAG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

4

Interacting miRNAs (#binding sites)

mmu-miR-101a-3p(1), mmu-miR-709(1), mmu-miR-377-3p(1), mmu-miR-7a-1-3p(1)

siRNAs for circular RNA silencing
Junction sequence

ATTTGTTTGCTAGGTGAGAGAATTGC

siRNA sets

ATTCTCTCACCTAGCAAAC, TTCTCTCACCTAGCAAACA, AATTCTCTCACCTAGCAAA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.942510705

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page