top of page

mmu_ciMysm1_485

Basic information of circular RNA
PanCircBase ID:

mmu_ciMysm1_485

mm39_Chr. Position ID:

chr4|94840614|94841099|-

Gene name:

Mysm1

Transcript:

ENSMUST00000075872.4

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

15

Exon/intron offsets:

0

Genomic length:

485

Exon/intron sizes in nt:

485

Flanking exon/introns:

chr4:94840599-94841099

Splice length:

485

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGTCTTCTTTTAAAACATTTCAGTTACCAGATGCTATACCAAATATTTTATAGAATTTAGAAAATATAATGAAAATATTGATTTATATCTTTATGTGTGAGAGTATGCAAGTATAGAAAGTTATATGTTCAGAAATGACTTAGCATTCCACATATGAGCATCTGTTTTCTATCAGAGGGAAAGGATTCTGCAGCCTTGGCTACACGCTACCTTCACCAGAGAAAAGCTACAACTAAGGGAAGGAATATATGCTAGTCTTATGGGTAAAAACTGATATTCATCATTCTGCTGAAATTATTTTCATATATAATAGGAACTGTTGAAAATGCAACATTTAGGCATTATAGTGCACTCTGGAAAACTAACCGTTATCATACCTTTTAGATTAGAAAGTGCTAGCTAAAGTCCTAGCCTACAGTCACACTTTGGGAATTTAATTTATTTGGCAAGTAATACAATTGGTTTCACTATAATCCTTCAAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

AGAAAGTGCTAGCTAAAGTCCT

56.83

TTGGTATAGCATCTGGTAACTG

55.34

140

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

AGAAAGTGCTAGCTAAAGTCCT

56.83

TTTGGTATAGCATCTGGTAACTG

56.08

141

PCR template sequence:

AGATTAGAAAGTGCTAGCTAAAGTCCTAGCCTACAGTCACACTTTGGGAATTTAATTTATTTGGCAAGTAATACAATTGGTTTCACTATAATCCTTCAAGGTAAGTCTTCTTTTAAAACATTTCAGTTACCAGATGCTATACCAAATATTTTATAGAATTTAGAAAATATAATGAAAATATTGATTTATATCTTTATGTG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

5

Interacting miRNAs (#binding sites)

mmu-miR-203-3p(1), mmu-miR-499-5p(1), mmu-miR-342-3p(1), mmu-miR-335-3p(1), mmu-miR-466b-3p(1)

siRNAs for circular RNA silencing
Junction sequence

ATAATCCTTCAAGGTAAGTCTTCTTT

siRNA sets

AGAAGACTTACCTTGAAGG, AAAGAAGACTTACCTTGAA, AAGAAGACTTACCTTGAAG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.869825694

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page