top of page

mmu_ciMan2b2_740

Basic information of circular RNA
PanCircBase ID:

mmu_ciMan2b2_740

mm39_Chr. Position ID:

chr5|36978440|36979180|-

Gene name:

Man2b2

Transcript:

ENSMUST00000031002.10

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

6

Exon/intron offsets:

0

Genomic length:

740

Exon/intron sizes in nt:

740

Flanking exon/introns:

chr5:36978424-36979180

Splice length:

740

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTATGACATGCTCCACTGGGTGCCCTCAATCCTGCCAGGGCCTCCCATGAAGCCTATGGAAAGAGCAGCCTGCACATGAGGCAGGCTCTAATCTAGCCCATCTCTACCCAGTTCTCAATGCTTCACCCATCCCTGCAGACCCCGGGGCCTTACCCACTCTTCTAAACTGCCCCTGACCTACCTCCAGGCTGATAGACAACCTCCACCTCCACCACTCACGTTGTCTGGGGCTGAAAGCCAGACTAACCTGCTCGGCTCTGCATACGTCGGGTGCCTTATCAGTGCAATGGATCTATAGAGTTATCTGCCATGAGGCTCACGAGAGGGGCATTCCTGGGGGACAGCCCCATACCCTGTCACTATTATTAAGCTGACTGCTCTGCAGGGTATCCGTCTAACCGGTACTTCTATAAGAGTTTTCTGGAATCATTTTGCAGCAGAGATCTGGGGCTCAGAGATGTAAAGGAACTGTCCGGAGGCCACACAGCTGCTTAGCTGTGCAAGTAGAAAGGGGTGGCATGACAGGTGACCCACTGCCTGCTTCCCCGATCCTGCTTGTGGTCAGGATGGGTGAATCAGGGCTATGTAACAATCATCATCACAGTTAATCCTAGTGATGGTTACGTAAGAGAAACCTGACAGCTACGGGAGTCTTGAGAGTGGCTGGGCTACTGGGGGTGTCAGTGATAAGCCCTCTTGCCTGGGAGAGGGCTCTGCGGTTCCCAGAGGTTCCGACCGCT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GGGGTGTCAGTGATAAGCCC

60.11

TTAGAGCCTGCCTCATGTGC

60.11

157

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GGGGGTGTCAGTGATAAGCC

60.11

TTAGAGCCTGCCTCATGTGC

60.11

158

PCR template sequence:

AGCTACGGGAGTCTTGAGAGTGGCTGGGCTACTGGGGGTGTCAGTGATAAGCCCTCTTGCCTGGGAGAGGGCTCTGCGGTTCCCAGAGGTTCCGACCGCTGTATGACATGCTCCACTGGGTGCCCTCAATCCTGCCAGGGCCTCCCATGAAGCCTATGGAAAGAGCAGCCTGCACATGAGGCAGGCTCTAATCTAGCCCA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

8

Interacting miRNAs (#binding sites)

mmu-miR-124-3p(1), mmu-let-7a-5p(1), mmu-let-7e-5p(1), mmu-miR-34c-5p(1), mmu-miR-34a-5p(1), mmu-miR-146a-5p(1), mmu-miR-363-3p(1), mmu-miR-98-5p(1)

siRNAs for circular RNA silencing
Junction sequence

GGTTCCGACCGCTGTATGACATGCTC

siRNA sets

ATGTCATACAGCGGTCGGA, GAGCATGTCATACAGCGGT, TCATACAGCGGTCGGAACC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.554097535

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page