top of page

mmu_ciKansl1l_1261

Basic information of circular RNA
PanCircBase ID:

mmu_ciKansl1l_1261

mm39_Chr. Position ID:

chr1|66763771|66765032|-

Gene name:

Kansl1l

Transcript:

ENSMUST00000129190.8

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

10

Exon/intron offsets:

0

Genomic length:

1261

Exon/intron sizes in nt:

1261

Flanking exon/introns:

chr1:66763771-66765032

Splice length:

1261

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTATGTATACTTACATGTTTCCTTTCTTCTTTCCTCAGTAAACTTAAATTCAGAGTCAAGTTATAACTAACAACAGAATGATTCCCCCTTCCCTATTTGCACAGAAGGAAAATGGTAAAAGGAAACTTTATAATAAACTAATTGATATTAGCATTCAAAATTGATTTTATCTATTGAGTATAGATATAATTGACTTTATCTATTGTGTGTATTTTACTAGCATGGTACTTTAGCCATGTAAAAACTACTACAACAAACAGTCCTTACCTTTTACGATAGAGATATACTTGGCTATATTTGTATGTGTATTCACACTGTTAAGACAGTAATGCTTGTTAACAAAAATAAGTTTCTGATTTATTTCTAATTCACCAATAAAAAAAAAATCAAATAGAAAAATGAAAGGGAAAGTCTAGGAAAATGGTTACACAGACACAAGTGTGGAAGGCCTGGCCAGACATGGAGGTTTGGAATAGTTTATACAAGAAGGCTGGGCTAAAGAAGACCCAGATTACAGTGTTCCTTGAATACATGCATAGATCTGCATCCATTTGCAGTGAAGGCAGCCATGTTTTATAGCAACAATGAAAGCAGTCTCTTATAAGATATAAATATGGCCCTAGAAAATAGAAAACGCTGGAGATAAACACAGACAGGTATCAGCCATATTCTGTCTGCCATCCATCTCCATTTTATTTCCATAAGTTCACTTACTACTTCTCAGTTAATCTGAGGAATAAGCCGGGCATTCTTATTAGGTACTATAGTTATATAGATACAGGATTGGCATTTTCTACAATAAGGAATGTTCTTGTAGTTATAGTGTTCCATAGCAACATTTTCAACCTACACTGGAGAATTCTGTGAGCCAGTTGTTAAGCAGTTAGTAACTAATTCCAAGGGGGCATGACACACATTTTCATACCAAAGAAAACTGGCAGATACTATGAATCAGGTTAGACTTCTCATTTTTGCTCAAGCCAGTTTATTAGATTACCACTGGGTTAATTCAAAACCAGCACATAATTTGAACTATATAGAAGAACAACTATATAGAAGAAACTACTTACTGTAAGGTATAAAGATTAATCTTCTGTTTTCTTTTTCTAAAAGTATTGTAAATGACAAACTATTAAAATGCAACCATTTGAATTATGGAAGTCTCGAGGAAATAAAACCCTAATGTATTTAGCTGTTTATAGAAAATAAAATTGTTATATTTGGATGAAAGCTGCTTGAAATTCTTTTGTATTTTCAACAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TGGATGAAAGCTGCTTGAAA

55.84

GCAAATAGGGAAGGGGGAATCA

60.09

140

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TTGGATGAAAGCTGCTTGAA

55.84

GCAAATAGGGAAGGGGGAATCA

60.09

141

PCR template sequence:

TCTCGAGGAAATAAAACCCTAATGTATTTAGCTGTTTATAGAAAATAAAATTGTTATATTTGGATGAAAGCTGCTTGAAATTCTTTTGTATTTTCAACAGGTATGTATACTTACATGTTTCCTTTCTTCTTTCCTCAGTAAACTTAAATTCAGAGTCAAGTTATAACTAACAACAGAATGATTCCCCCTTCCCTATTTGC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

14

Interacting miRNAs (#binding sites)

mmu-miR-9-5p(1), mmu-miR-19b-3p(1), mmu-let-7c-5p(1), mmu-miR-204-5p(1), mmu-miR-19a-3p(1), mmu-miR-196a-5p(1), mmu-miR-149-5p(1), mmu-miR-98-5p(1), mmu-miR-466a-5p(1), mmu-miR-1187(1), mmu-miR-466p-5p(1), mmu-miR-335-3p(1), mmu-miR-669d-5p(1), mmu-miR-3105-3p(1)

siRNAs for circular RNA silencing
Junction sequence

GTATTTTCAACAGGTATGTATACTTA

siRNA sets

TAAGTATACATACCTGTTG,AAGTATACATACCTGTTGA,ACATACCTGTTGAAAATAC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.881564446

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page