top of page

mmu_ciImmt_58

Basic information of circular RNA
PanCircBase ID:

mmu_ciImmt_58

mm39_Chr. Position ID:

chr6|71851910|71851968|+

Gene name:

Immt

Transcript:

ENSMUST00000207003.2

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

13

Exon/intron offsets:

0

Genomic length:

58

Exon/intron sizes in nt:

58

Flanking exon/introns:

chr6:71851910-71854232

Splice length:

58

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGGCCTAGGAAGAGTTGTGTAATGTCATATTTCATATCAAAGAAAATCAGCATTG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

NA

NA

NA

NA

NA

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

NA

NA

NA

NA

NA

PCR template sequence:

ATATTTCATATCAAAGAAAATCAGCATTGGTAAGGCCTAGGAAGAGTTGTGTAATGTC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

1

Interacting miRNAs (#binding sites)

mmu-miR-323-3p(1)

siRNAs for circular RNA silencing
Junction sequence

AAAATCAGCATTGGTAAGGCCTAGGA

siRNA sets

TAGGCCTTACCAATGCTGA,CTAGGCCTTACCAATGCTG,TCCTAGGCCTTACCAATGC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.394401831

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page