top of page

mmu_ciHsp90ab1_61

Basic information of circular RNA
PanCircBase ID:

mmu_ciHsp90ab1_61

mm39_Chr. Position ID:

chr17|45882629|45882690|-

Gene name:

Hsp90ab1

Transcript:

ENSMUST00000024739.14

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

2

Exon/intron offsets:

0

Genomic length:

61

Exon/intron sizes in nt:

61

Flanking exon/introns:

chr17:45882545-45882690

Splice length:

61

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTGAGTATTCTGTTGTTGAATTTCTAAGGCTTCACGGAAGTGTGTGTGTGTGTGGGAGTGA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

NA

NA

NA

NA

NA

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

NA

NA

NA

NA

NA

PCR template sequence:

TCACGGAAGTGTGTGTGTGTGTGGGAGTGAGTGAGTATTCTGTTGTTGAATTTCTAAGGC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

1

Interacting miRNAs (#binding sites)

mmu-miR-188-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TGTGTGGGAGTGAGTGAGTATTCTGT

siRNA sets

TACTCACTCACTCCCACAC, ATACTCACTCACTCCCACA, ACTCACTCACTCCCACACA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.749962769

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page