top of page

mmu_ciGxylt1_1029

Basic information of circular RNA
PanCircBase ID:

mmu_ciGxylt1_1029

mm39_Chr. Position ID:

chr15|93162722|93163751|-

Gene name:

Gxylt1

Transcript:

ENSMUST00000057896.5

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

2

Exon/intron offsets:

0

Genomic length:

1029

Exon/intron sizes in nt:

1029

Flanking exon/introns:

chr15:93159799-93163751

Splice length:

1029

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAGGCCCTTAATATTTAATTAGTAGATGAGAGTAGGTAAGATTAGATAGTAGATGATCAAACATTTCACTGTATAAAACTTTCTTTTCCTGTATTTCAGTATCATATAACTAAGTTGATTTTTCTGGTTGGGTTTTCTCTTCCTTTTCTCATCTTTTACTTATTAACTTTAATAATACTATGTGTAAATGCTCAATTTTTCCAAATGTTATTAAGATAAGCTATAGCTTTTAGAGGAATTTGTGGTTGAGCTTAACTGATAAATTGATACCTAGGTGTGTTCTAGGTTGATAGAATATCCTGACTACTGCAGCTTGGGAGGAAAGGGTGTATTTGGTTTGTACTTCCAGGTCACACAGTCCATTTCTGAAGGACGGCAGGGGAGGGACTCAAGGCAGGAACATGGACAAGTGCTGCTTGCTGGATTTCTTGCATGCTTACCTCAGCTGCCCTTATAGAGCCAAGGCCCTCCTACCTCTGGGTGGTACCTCCCACACTGTTCATTACGACAGTCCCACAAACATGCCCACATGCCATTCTGATCTAGGTGTTCTGCTCTCGGATGACTCTTAAGCTGTGTCAAGTCAACAATTTATGTAGACAAGATGATAAAAGGCTTCCATTAGACATTACAGATAGTGTGTGTTTATACATGCAGTTATCTAAAGCTAGAATCTTTAATACTGGGTATTTAGTACCCAGTATTTATAAATCCTGGGGCAGGTGAGATTGTTCATCTGGTAAAGATACTGGAGCTGACATGCCTCACACTGCGTTGGCTCTCAGGACACATAGTGGAGGAAGATGATTGCCTCCTGCAGGTGACCCTTTGGCATCCATGTGTGTACTGTGTGTGTATACCCGCCTCAAATAAATAAAATATTAAAAAACCCAAAAGGTAGTGTGCTACAACACTCTTGGAGGGGATGTGACAGCTAAGGAAGGATTGTGTTATCTTTAGCCTGGAGGTGTTAGGGGAAGCGGAGGGTAAAGACATCCTTACTGAAGGAGTGTAACCTTTTAAGTCAC

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

CTGGAGGTGTTAGGGGAAGC

59.75

ACAGTGAAATGTTTGATCATCTACT

56.77

140

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TAGCCTGGAGGTGTTAGGGG

60.33

ACAGTGAAATGTTTGATCATCTACT

56.77

144

PCR template sequence:

TGACAGCTAAGGAAGGATTGTGTTATCTTTAGCCTGGAGGTGTTAGGGGAAGCGGAGGGTAAAGACATCCTTACTGAAGGAGTGTAACCTTTTAAGTCACGTAGGCCCTTAATATTTAATTAGTAGATGAGAGTAGGTAAGATTAGATAGTAGATGATCAAACATTTCACTGTATAAAACTTTCTTTTCCTGTATTTCAG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

22

Interacting miRNAs (#binding sites)

mmu-let-7a-5p(1), mmu-miR-16-5p(1), mmu-miR-429-3p(1), mmu-miR-200b-3p(1), mmu-let-7e-5p(1), mmu-let-7b-5p(1), mmu-miR-200c-3p(1), mmu-let-7c-5p(1), mmu-miR-322-5p(1), mmu-miR-15b-5p(1), mmu-miR-216a-5p(1), mmu-miR-217-5p(1), mmu-miR-203-3p(1), mmu-let-7d-5p(1), mmu-miR-199b-3p(1), mmu-miR-199a-3p(1), mmu-miR-425-5p(1), mmu-miR-383-5p(1), mmu-miR-466d-3p(1), mmu-miR-705(1), mmu-miR-452-3p(1), mmu-miR-466b-3p(1)

siRNAs for circular RNA silencing
Junction sequence

CCTTTTAAGTCACGTAGGCCCTTAAT

siRNA sets

ATTAAGGGCCTACGTGACT, TTAAGGGCCTACGTGACTT, TAAGGGCCTACGTGACTTA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.783569982

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page