top of page

mmu_ciGolga1_805

Basic information of circular RNA
PanCircBase ID:

mmu_ciGolga1_805

mm39_Chr. Position ID:

chr2|38923267|38924072|-

Gene name:

Golga1

Transcript:

ENSMUST00000039165.15

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

14

Exon/intron offsets:

0

Genomic length:

805

Exon/intron sizes in nt:

805

Flanking exon/introns:

chr2:38923264-38924072

Splice length:

805

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTGAGTGGAGTGAGCGTCAGCACATGCAGGAGCACTGTGTCACTGCCACTAAGCAGAATGGTGCCTCTCTAGGCTGGGGAACCACTTGAGAGGGCAGTTCACCTTTCCCATAAGTATTTAAACTGCTTAGGAGACTGGAAGTAAAAAGACTTCTCTTTACAGAGATGCACAGCAGATGTGTTCACCACAGGGACAACTCCCTGATCTCTAATATTCCCCTTGGGTTTTTCTGAAATCCATATTGTCCCTTCCTAATGGCTTCTCTCTTCTACAATGCCTCTGTGTCCTACAGTGTTAAGAGACGTGATTTTCTTAAGGACCTAGAGATCGAGCCTCATACCTGCTAGGCTCTATAGCTGAGCCACTGTCCCACCCCTGGAGAGTTCCAGGTTTTCTTCCTTGTCCCTACCTGTTGTTTACTCGATGCTTACGGTGACTGAAATAAAGGTAATTTCTTTAATGGAGGCCAGAGATTATATATGAGCTATCTTCCTCAGTTGCTTTCCATCTAACTTTTTGAGATAGAATGTCACTAATTTGGCCAGAATAGCTGACCAACAACCCCCAGAGTGCCACCAGGCTCTGCCCAGCACTGGAATTACAGGTGTGCACCACCACTCCCAACTTTTTCACATGGGTGTTGGGAATCTGAATTCAGATTCTCATACCTTCATAAGCACATTATCAGCTGAGCAATTTCCTCAGCCCAAGAAAGGTTATTTCAAAAGGACATCAGAGAGATCAGACTGCTTATGAGAAAATATGGCAGGTAAGGCCTATTCTTATTAGTGCTCTGCTCAATTTA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GGACATCAGAGAGATCAGACTGC

60.24

CAAGTGGTTCCCCAGCCTAG

60.04

166

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GGACATCAGAGAGATCAGACTGC

60.24

AAGTGGTTCCCCAGCCTAGA

60.18

165

PCR template sequence:

CCCAAGAAAGGTTATTTCAAAAGGACATCAGAGAGATCAGACTGCTTATGAGAAAATATGGCAGGTAAGGCCTATTCTTATTAGTGCTCTGCTCAATTTAGTGAGTGGAGTGAGCGTCAGCACATGCAGGAGCACTGTGTCACTGCCACTAAGCAGAATGGTGCCTCTCTAGGCTGGGGAACCACTTGAGAGGGCAGTTC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

9

Interacting miRNAs (#binding sites)

mmu-miR-34a-5p(2), mmu-miR-140-5p(1), mmu-miR-200a-3p(1), mmu-miR-141-3p(1), mmu-miR-128-3p(1), mmu-miR-382-5p(1), mmu-miR-539-5p(1), mmu-miR-452-3p(1), mmu-miR-490-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TCTGCTCAATTTAGTGAGTGGAGTGA

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.813418516

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page