top of page

mmu_ciGm28364_98

Basic information of circular RNA
PanCircBase ID:

mmu_ciGm28364_98

mm39_Chr. Position ID:

chr1|74320597|74320695|+

Gene name:

Gm28364

Transcript:

ENSMUST00000187908.2

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

1

Exon/intron offsets:

0

Genomic length:

98

Exon/intron sizes in nt:

98

Flanking exon/introns:

chr1:74320597-74320969

Splice length:

98

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGAAAAGAGGCTCACAGACCTGGACAAAGAGGGAAAAGACAGGGGAGGTGCAGAAGGTCCAGACAAAGAAGCCCAGGCTACTTACCTTGCCAGTG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GGTGCAGAAGGTCCAGACAA

59.89

TTTGTCCAGGTCTGTGAGCC

59.89

80

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GGTCCAGACAAAGAAGCCCA

59.89

TTTGTCCAGGTCTGTGAGCC

59.89

71

PCR template sequence:

GGTGCAGAAGGTCCAGACAAAGAAGCCCAGGCTACTTACCTTGCCAGTGGTAAGAAAAGAGGCTCACAGACCTGGACAAAGAGGGAAAAGACAGGGGA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

NA

Interacting miRNAs (#binding sites)

NA

siRNAs for circular RNA silencing
Junction sequence

TACCTTGCCAGTGGTAAGAAAAGAGG

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.383836145

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page