top of page

mmu_ciGm20721_637

Basic information of circular RNA
PanCircBase ID:

mmu_ciGm20721_637

mm39_Chr. Position ID:

chr2|174175367|174176004|-

Gene name:

Gm20721

Transcript:

ENSMUST00000168292.2

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

12

Exon/intron offsets:

0

Genomic length:

637

Exon/intron sizes in nt:

637

Flanking exon/introns:

chr2:174172227-174176004

Splice length:

637

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

CTGAGAAAGGAAAGTGAGGGCGTGGGTTAAGAAACAGGCTTGTCACACTTCACCTGGATGATGGCCTTGGAAAGCAGCAGAAGCAGCACACAACAGACACACAATGACACAACTGCAAACCTCCTTCACATGACGACGCAGTGAAAAACAACAGACACATCCAACATAGCATCTACCTGAAGTATCTCACCATAGAGTAACAAGCAAGAATTAAGGGCTCTGCTGTTTTTAAATAGCTTTTTTTTTCCCTTTTGAGTTTTGTTGTTGTTGTTTTGTTTTCTCTTTGGGTTTTTTAAACTCATGAGGCGATGAAGGAATGACGTAATTGTCACTGGAAGGGTGAAAATTTTAAGTCAAAACTGTGAATTTAGTATTGAAATGTGGTCAAAGGTACTCTATGCAGCAGCCACCTAATTTCCTGTTTGTTAGTCATTTTATGGTTAAAATACTTAGGAATGGCAGACAATGCCTAGACACTGCAGTCTCCCACTATCACGCCCCGCTGCAGCACCTCCCTCCCAACGCCACAATGCAGCTGCTCTCAAGCATGCTTCAGGTCCACCCTAAAACCACAGGGCTACACTGTATCCACTGTATCCACTCCCTTCCCCTGCAAAAGGAATCTTTCTAAAGATAC

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TCAAGCATGCTTCAGGTCCA

59.6

CTTCTGCTGCTTTCCAAGGC

59.76

179

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TCAAGCATGCTTCAGGTCCA

59.6

GCTTCTGCTGCTTTCCAAGG

59.76

180

PCR template sequence:

GCTCTCAAGCATGCTTCAGGTCCACCCTAAAACCACAGGGCTACACTGTATCCACTGTATCCACTCCCTTCCCCTGCAAAAGGAATCTTTCTAAAGATACCTGAGAAAGGAAAGTGAGGGCGTGGGTTAAGAAACAGGCTTGTCACACTTCACCTGGATGATGGCCTTGGAAAGCAGCAGAAGCAGCACACAACAGACAC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

7

Interacting miRNAs (#binding sites)

mmu-miR-122-5p(1), mmu-miR-205-5p(1), mmu-miR-33-5p(1), mmu-miR-705(1), mmu-miR-1187(1), mmu-miR-3065-5p(1), mmu-miR-1904(1)

siRNAs for circular RNA silencing
Junction sequence

TTTCTAAAGATACCTGAGAAAGGAAA

siRNA sets

TTTCTCAGGTATCTTTAGA,TTTCCTTTCTCAGGTATCT,TTCCTTTCTCAGGTATCTT

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.707339705

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page