top of page

mmu_ciGcfc2_779

Basic information of circular RNA
PanCircBase ID:

mmu_ciGcfc2_779

mm39_Chr. Position ID:

chr6|81920522|81921301|+

Gene name:

Gcfc2

Transcript:

ENSMUST00000152996.8

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

10

Exon/intron offsets:

0

Genomic length:

779

Exon/intron sizes in nt:

779

Flanking exon/introns:

chr6:81920522-81921387

Splice length:

779

Other database IDs:

circAtlas: mmu-Gcfc2_0008

Human Ortholog IDs:
Mature spliced Sequence:

GTCAATTGCCAAGATTCTAACCTATTTTGAGATGTTGAAATAGTGAGGAAGGCTTTGTTGTGGCTGCCTTTAAATCCATATTACTAAGACAGGGAAATACAAGAAAGATGTAAACATTTTCTGCATAAGATTTGCTGCCCCGTCCACCCAGCAGGGGCATCCACACCTCTAATAAACCTTACCAAAAAAAAAGAAAAAAGAAAAAAAGAAAACCTTGGAAAAAACCTTGAGAAACAAAACGTACTTGCCAGTTAGTGAAAGTACAGACACCCAAGAGGCTTCAGGCCTCCATGCTGACTGGAGAGTTCACTGAGATGCACAGTTGGGAAGTTGACAAATGTCTGGTTTGAGGGTTTAATTTAATCAGCTTTGTGATGCTTTTACTTTGAGTTCATTATAATAAAGTGCCTTTTAAAGTAGTTCACTGACTTAGTTGTGCAAGTTACAGATGATGCCATCTAAGGAAAGCAACGCAGCCACAGTGCCCACTGTAACCCAGCAGGCAGCAACAATGCGCCCTGGGAGCAGAGCTCACAGCACTGCCTGTCCAGAGGCAGCAAGAAGTGTATGGTATTTTGGCATATATACAGGAACTCAATACACAGTAGGATTTATTACTGTTGATATTATCACTTTTGGTATTAAAGTGACTTTTTAAATAAAATGAATATATGAAATAACAAAAGTTTCCAGCCCAGTTGGTTAGGTAGCAACTCGTGACTGTTGGTAAGGAAACAGGCTTAAAATGCATAACATAAAGAGACTTACTTTGTTTGCAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

AGTTTCCAGCCCAGTTGGTT

59.74

CAGCCACAACAAAGCCTTCC

59.97

161

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

AAGTTTCCAGCCCAGTTGGT

59.74

CAGCCACAACAAAGCCTTCC

59.97

162

PCR template sequence:

ACAAAAGTTTCCAGCCCAGTTGGTTAGGTAGCAACTCGTGACTGTTGGTAAGGAAACAGGCTTAAAATGCATAACATAAAGAGACTTACTTTGTTTGCAGGTCAATTGCCAAGATTCTAACCTATTTTGAGATGTTGAAATAGTGAGGAAGGCTTTGTTGTGGCTGCCTTTAAATCCATATTACTAAGACAGGGAAATAC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

7

Interacting miRNAs (#binding sites)

mmu-miR-370-3p(2), mmu-miR-34c-5p(1), mmu-miR-34a-5p(1), mmu-miR-212-3p(1), mmu-miR-34b-5p(1), mmu-miR-224-5p(1), mmu-miR-350-3p(1)

siRNAs for circular RNA silencing
Junction sequence

ACTTTGTTTGCAGGTCAATTGCCAAG

siRNA sets

ATTGACCTGCAAACAAAGT, AATTGACCTGCAAACAAAG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.731023782

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page