top of page

mmu_ciEtfa_563

Basic information of circular RNA
PanCircBase ID:

mmu_ciEtfa_563

mm39_Chr. Position ID:

chr9|55394120|55394683|-

Gene name:

Etfa

Transcript:

ENSMUST00000034866.9

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

6

Exon/intron offsets:

0

Genomic length:

563

Exon/intron sizes in nt:

563

Flanking exon/introns:

chr9:55394087-55394683

Splice length:

563

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGCATTCTCATATGAGCCTTTTCAATAGGTTGGCATTTCTTGTTTGTTTGGCTTAGATTAGAAAACGGGTCGGTGTCTACTTTAACTTGTAATGCAAAGTAAAAATTCAACTGACTCATATTCCAAGGTTATGTAAATAATTGTAATTTATGTCTGTTTCACATCATCTTGGTACAAGGATAATCACTTTGGTAGATTAAAAGTAGGAGAGGAGATAAATTACAATGAAACTTACATTTATGTTAGGGCTGTTTAACTCATTACTCTTTCCTAGTGTGGTATTTGAGTGATTCAACATAATAGGAGAATGTAATAATGGTAGAAATAGGACTTCCACTTTAACATGTCTGGCATCTTATTTGAACACTAGAGAGAATGGGTTATTCTGGTTTTTACAGATGAACTTATGAGTAGTATCAACTTCTCAAGAGTCGTACCCTCTTAACACTTTTTAATTAAAGAAAATGAATTTGGGACTGTGAAAATGTAGGAACTTAAGTTTTCTAGTATTGGATGTTTTTGTGTTGGTCTTAAAAATAATTACCACTATATATTTGAAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TGGGACTGTGAAAATGTAGGAACT

59.9

GTAGACACCGACCCGTTTTCT

60

172

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TGGGACTGTGAAAATGTAGGAACT

59.9

AGTAGACACCGACCCGTTTTC

60

173

PCR template sequence:

GAAAATGAATTTGGGACTGTGAAAATGTAGGAACTTAAGTTTTCTAGTATTGGATGTTTTTGTGTTGGTCTTAAAAATAATTACCACTATATATTTGAAGGTAAGCATTCTCATATGAGCCTTTTCAATAGGTTGGCATTTCTTGTTTGTTTGGCTTAGATTAGAAAACGGGTCGGTGTCTACTTTAACTTGTAATGCAA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

4

Interacting miRNAs (#binding sites)

mmu-miR-27b-3p(1), mmu-miR-27a-3p(1), mmu-miR-495-3p(1), mmu-miR-362-5p(1)

siRNAs for circular RNA silencing
Junction sequence

TATATATTTGAAGGTAAGCATTCTCA

siRNA sets

AATGCTTACCTTCAAATAT

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.895716582

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page