top of page

mmu_ciElapor2_632

Basic information of circular RNA
PanCircBase ID:

mmu_ciElapor2_632

mm39_Chr. Position ID:

chr5|9490983|9491615|+

Gene name:

Elapor2

Transcript:

ENSMUST00000155764.8

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

14

Exon/intron offsets:

0

Genomic length:

632

Exon/intron sizes in nt:

632

Flanking exon/introns:

chr5:9490983-9491633

Splice length:

632

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGGACGTGGCTGTCCAGTTACTCCCTCTGGGGTGGTGGAGGCAGAGGTGGTGGAGTTGCTATCGATGCTGGAAAATGCTCTGCAATTCTCATTCCTGTTTTCTCTTCTCTTACATTAATTGAGCTCTGAATTTATGCTGTGGAAATGCTGGTTACTAGTCACAAAATATGAGGGAAAATATTTAATAAGAAGTTTTTCAAAAATACTACAATTGATATCTTGTGCATTTCCAAGATAGGAGGAGCTGTCCTGTGAGCTGGGTGTAGGAGTGCCTGGGGAAGCAATACTCGTGGTGTACAGCATTTCAAGTTTGAAGCAAATCAGCAAGCCAGCAGATCAGAGTAGCTTAACGCAAATGTTTTATTGTCTGTGAAAGCAGGCCTCATGGAAAGATTTTAGTATTTCTTAAAAATAGCTTCCCATAAGGAGGTTATCTGAGAAAATATCCCTGATTAAAAAAATCTTGACTCTTCTGCACTTTTTATAGAGACATTTAGCAATTAGGAATCCTCTATCCCTGGTATAACAAAATATAACTAAGACAAAAATTACTGGAAGATTTTATAGCTAGAACTTTTGAAAACATTTTCTTCATAGTAGTTATTAACTTTCTGCATTATTGTTTGTTT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

ACTGGAAGATTTTATAGCTAGAACT

55.55

TCGATAGCAACTCCACCACC

59.46

147

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

ACTGGAAGATTTTATAGCTAGAACT

55.55

CGATAGCAACTCCACCACCT

59.46

146

PCR template sequence:

AATATAACTAAGACAAAAATTACTGGAAGATTTTATAGCTAGAACTTTTGAAAACATTTTCTTCATAGTAGTTATTAACTTTCTGCATTATTGTTTGTTTGTAAGGACGTGGCTGTCCAGTTACTCCCTCTGGGGTGGTGGAGGCAGAGGTGGTGGAGTTGCTATCGATGCTGGAAAATGCTCTGCAATTCTCATTCCTG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

10

Interacting miRNAs (#binding sites)

mmu-miR-20b-5p(1), mmu-miR-134-5p(1), mmu-miR-106a-5p(1), mmu-miR-20a-5p(1), mmu-miR-17-5p(1), mmu-miR-106b-5p(1), mmu-miR-203-3p(1), mmu-miR-495-3p(1), mmu-miR-207(1), mmu-miR-338-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TTATTGTTTGTTTGTAAGGACGTGGC

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.856237637

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page