top of page

mmu_ciDut_186

Basic information of circular RNA
PanCircBase ID:

mmu_ciDut_186

mm39_Chr. Position ID:

chr2|125099060|125099246|+

Gene name:

Dut

Transcript:

ENSMUST00000082122.14

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

6

Exon/intron offsets:

0

Genomic length:

186

Exon/intron sizes in nt:

186

Flanking exon/introns:

chr2:125099060-125099276

Splice length:

186

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTGAGTACTGGAAACTGAGCGGAGAATGCCTGGTGTGTGTGTCCAGTGGAGGAGGGGCGGCTCAGCTGATGAGCTGTGGGGCTAGTGACTGGTAGTCTTCAAGCAAGGTTAGGTGTTTAGTTTGAGACTTGATTGGCTTTCCTCAGAATGGGTCCGTGCAGTGTGCAGAGGCTCTGACTGCCGCTC

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TTCCTCAGAATGGGTCCGTG

59.39

CTAGCCCCACAGCTCATCAG

59.89

133

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TTCCTCAGAATGGGTCCGTG

59.39

CACTAGCCCCACAGCTCATC

60.18

135

PCR template sequence:

AGTCTTCAAGCAAGGTTAGGTGTTTAGTTTGAGACTTGATTGGCTTTCCTCAGAATGGGTCCGTGCAGTGTGCAGAGGCTCTGACTGCCGCTCGTGAGTACTGGAAACTGAGCGGAGAATGCCTGGTGTGTGTGTCCAGTGGAGGAGGGGCGGCTCAGCTGATGAGCTGTGGGGCTAGTGACTGGT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

1

Interacting miRNAs (#binding sites)

mmu-miR-363-3p(1)

siRNAs for circular RNA silencing
Junction sequence

CTGACTGCCGCTCGTGAGTACTGGAA

siRNA sets

TTCCAGTACTCACGAGCGG,TCCAGTACTCACGAGCGGC,TACTCACGAGCGGCAGTCA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.55296685

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page