top of page

mmu_ciDnm2_729

Basic information of circular RNA
PanCircBase ID:

mmu_ciDnm2_729

mm39_Chr. Position ID:

chr9|21401090|21401819|+

Gene name:

Dnm2

Transcript:

ENSMUST00000165766.9

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

13

Exon/intron offsets:

0

Genomic length:

729

Exon/intron sizes in nt:

729

Flanking exon/introns:

chr9:21401090-21401953

Splice length:

729

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAGCTCCCCAGTCTCTGCTGTCACTCCCTTCTGAAGACAGGAGCATACTTAGCTCATCATAGCATTTGATATGGGAACCGACTCCTTAGTACTAGGCTGCTCTGTCAGCTTCTGGGTCATGTAGCTGTTAGAACTAAGGCTTCCACAGGACCTTGGGGCAAATTGCAAACACCCAAAGGCCTCATCTGACATCTAATGTGAAAGTTACAACTTGACCCTCAAAGCAGGAGATGTGTTACAGTGACCCCGAGGTGTATGTTTTCTAACTCTTGGCCCCAGGAATGAAGGCAGGTAGGTAGAAACCATGGAAAGTGCCACAGGCAACTCAGGGAAGATGGGGATGGTTTGAATGCCACGGCTGGAGAACCCCAGGCCTCCTTTATAATCCCACCCCAGCTTCAGAGGCTTCGCATACTTACAGATGGCTTCAGAGATGCCAGTATTACGTGTCTGGTTGGGCTTGTTTTTCTGTCCAGTTTCTGCACTGTCCCCCAATTCCCTTCCCATGTCAGACTGGGGTGGGGATGGGGCGCTGTGCTGTTTTATCTTGCACGATTTAGAGCCAGATGGGGAGAAATGTAACAAATGCATGATTTTGAGTTTTCTTTTTGTATGTGTGCTTGCCATAGGTAGTACATATGTTGTTGCTTTTTTTTGTTTTGATGAAGATAATGAATTAAATATTAACACCATGAATATAATTAATAGCATGTAATTTTTTTCTTTTG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GGTAGTACATATGTTGTTGCTTTT

55.7

TGCTCCTGTCTTCAGAAGGG

59.02

146

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GGTAGTACATATGTTGTTGCTTTT

55.7

GCTCCTGTCTTCAGAAGGGAG

59.79

145

PCR template sequence:

GGTAGTACATATGTTGTTGCTTTTTTTTGTTTTGATGAAGATAATGAATTAAATATTAACACCATGAATATAATTAATAGCATGTAATTTTTTTCTTTTGGTAGCTCCCCAGTCTCTGCTGTCACTCCCTTCTGAAGACAGGAGCATACTTAGCTCATCATAGCATTTGATATGGGAACCGACTCCTTAGTACTAGGCTG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

8

Interacting miRNAs (#binding sites)

mmu-miR-205-5p(1), mmu-miR-351-5p(1), mmu-miR-130b-3p(1), mmu-miR-192-5p(1), mmu-miR-215-5p(1), mmu-miR-680(1), mmu-miR-29b-2-5p(1), mmu-miR-670-5p(1)

siRNAs for circular RNA silencing
Junction sequence

TTTTTTTCTTTTGGTAGCTCCCCAGT

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.735352603

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page