top of page

mmu_ciDmxl1_873

Basic information of circular RNA
PanCircBase ID:

mmu_ciDmxl1_873

mm39_Chr. Position ID:

chr18|50094342|50095215|+

Gene name:

Dmxl1

Transcript:

ENSMUST00000180611.8

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

42

Exon/intron offsets:

0

Genomic length:

873

Exon/intron sizes in nt:

873

Flanking exon/introns:

chr18:50094342-50095239

Splice length:

873

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAATACAGTTGATACATGGTATCTGTAATATGAAAAAAATTAGAAACTTAGGCCTTTATATTTATGATACCAACATATTCCAAATAATAGTTGAATCAGTTCTATTTTAGCCAACAATGCTAATTACTGTTTAATAAGTCCTTTAGTGAATGGACATACTTTTAACTTTAAATTTTATATTTTTACTAGTTTTGAAATATACTTAATTAATGCTTAAGAATTAAATTTTCTATGGATTTAAATATATTTCAGATATTATAAGAAGATAAGTCTTGACTCTATTCTTTGTTATATGGTTACTAAATTTCTAGGTTAGCTGAATATATCCTAGCAGAATTATTTTTCTTTGATTTGAAGCCACTTTTTAAATTTCAACGTGTTGCTGCTGGTAAAGGCCACCAGGGTTTCAATTCTCATCACTCTCAGAGAAATAAACAAGAGAAAGCAAAGAACTGAGAAGAAATTTTATAACAAAGTAGAATTACACACTCAAGCATCATGTGGCTAGAACTTTGGATAATTCATTTTATAAGCAAATCTAAATAGAGGGCAGGATTGGTCAGAAGATGAAGTCCGACAGGGTAATCTAGGAATAGGTTTGGGATTTTTTCCTGAATAGAGTTTTCTCCCCCTTTCCTGTATTTGCATCTTCAGTGCATTAACAATAATTCCTACTCTCAGTGGATGGACTTTGAGTAACAAAAAAAAAAAAAAAGCAATTGATGAATGGTCATAGCCTATAGAGAATCAGGAGACTGTGATCAGAGCTCACACAGGCACTGATTGTCCTTGTTTTAGAAATGTCCTAACTGCACAGGAAGGGAGTTGCATTTTATTTGGAATTCATAAATCAATCACCAGCCTCCACTTT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

ACTGCACAGGAAGGGAGTTG

59.89

TGTTGGTATCATAAATATAAAGGCCT

56.53

140

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

ACTGCACAGGAAGGGAGTTG

59.89

TGTTGGTATCATAAATATAAAGGCC

55.24

140

PCR template sequence:

CACAGGCACTGATTGTCCTTGTTTTAGAAATGTCCTAACTGCACAGGAAGGGAGTTGCATTTTATTTGGAATTCATAAATCAATCACCAGCCTCCACTTTGTAAATACAGTTGATACATGGTATCTGTAATATGAAAAAAATTAGAAACTTAGGCCTTTATATTTATGATACCAACATATTCCAAATAATAGTTGAATCA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

13

Interacting miRNAs (#binding sites)

mmu-miR-16-5p(1), mmu-miR-15a-5p(1), mmu-miR-27b-3p(1), mmu-miR-27a-3p(1), mmu-miR-322-5p(1), mmu-miR-15b-5p(1), mmu-miR-138-5p(1), mmu-miR-10b-5p(1), mmu-miR-382-3p(1), mmu-miR-384-3p(1), mmu-miR-410-3p(1), mmu-miR-5101(1), mmu-miR-335-3p(1)

siRNAs for circular RNA silencing
Junction sequence

CAGCCTCCACTTTGTAAATACAGTTG

siRNA sets

TATTTACAAAGTGGAGGCT, CAACTGTATTTACAAAGTG, ATTTACAAAGTGGAGGCTG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.913918565

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page