top of page

mmu_ciDdx56_403

Basic information of circular RNA
PanCircBase ID:

mmu_ciDdx56_403

mm39_Chr. Position ID:

chr11|6214272|6214675|-

Gene name:

Ddx56

Transcript:

ENSMUST00000004507.11

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

7

Exon/intron offsets:

0

Genomic length:

403

Exon/intron sizes in nt:

403

Flanking exon/introns:

chr11:6214237-6214675

Splice length:

403

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTGAGTCCACGGTTCTCTTTTTTCATCATTCCTCCGAGAGGACTGTTTTCAGCCTCTGTAAGACTGAGCCAAAGTGCATAGAGTGAGTGAGTTGTCAGACATTCTCGGTGGTTATACCTGGCAGTCCCACGGGCCCTTGCTTAGCTTCCTGGGCAGACATAGAGTAGAGGGTGATGCCCACATGTGCAGCACAGAGTGTCAGGGTCCCAGAGGCGGTTTATGGGTCAGTATGTTCTGCTATTGCCCAGGGCTAAGGTCAGGGCACAGGTTTGCCTGCATGTCAGAACTCCGGTCCACCCTCCAACACCCCAGCTCCTGGAGTGATTCTAATGTTTGGAGGTCTTTCAGCTTTGCTTAGAGGAGAGATGGCTTAGAGATATATGTGAGAACACATTCCCAGAGG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TGGAGGTCTTTCAGCTTTGCT

59.86

TGCACTTTGGCTCAGTCTTACA

60.16

147

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TGGAGGTCTTTCAGCTTTGCT

59.86

ATGCACTTTGGCTCAGTCTT

57.72

148

PCR template sequence:

ACACCCCAGCTCCTGGAGTGATTCTAATGTTTGGAGGTCTTTCAGCTTTGCTTAGAGGAGAGATGGCTTAGAGATATATGTGAGAACACATTCCCAGAGGGTGAGTCCACGGTTCTCTTTTTTCATCATTCCTCCGAGAGGACTGTTTTCAGCCTCTGTAAGACTGAGCCAAAGTGCATAGAGTGAGTGAGTTGTCAGAC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

4

Interacting miRNAs (#binding sites)

mmu-miR-326-3p(1), mmu-miR-24-3p(1), mmu-miR-3087-3p(1), mmu-miR-193b-3p(1)

siRNAs for circular RNA silencing
Junction sequence

ACATTCCCAGAGGGTGAGTCCACGGT

siRNA sets

CGTGGACTCACCCTCTGGG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.636411541

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page