top of page

mmu_ciDdb1_655

Basic information of circular RNA
PanCircBase ID:

mmu_ciDdb1_655

mm39_Chr. Position ID:

chr19|10591555|10592210|+

Gene name:

Ddb1

Transcript:

ENSMUST00000025649.10

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

8

Exon/intron offsets:

0

Genomic length:

655

Exon/intron sizes in nt:

655

Flanking exon/introns:

chr19:10591555-10592215

Splice length:

655

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTGAGAAAACATCATCTTCCTGGTTTTCTTTTCACTATGCTTATAATTTTCTTCATTAAATTTGTTTGTTGTCTGGCTGGACTTTGGTTTCTTCAGATCTCTGCTATCTACCTCTCTGCTCTATTAACTTCTTACCTGTGTCTTGATAGTTCTTTAGTAAATATGTCTGGCAGAGTGAAGGTCCCTATACATTTAGTGATGAACAAGACCTCAAGTGGGTCATGGTCTAATGTAATGGATAGATCCCTTCTGTCATAGGTAAACTTTGGACATTCCTCCTAAAAAAATGCTTCTATTTTAATTTAATTAATTTAAATGCATGTTTATTTGTTTTATTTTTTGAGACACGGTCTCTCTAGGCTGTCCTGGAACTCGCTCTGTAGACCAGGCTACCTTGAATTCAGAGATCTGCCTGCCTCTGCCTCCCGAGTATTGGGATTAAAGGCATGTGCTACCACTGCCCGGCATACATTTTAAGTTTTTAAAAATTTACTGCTTCTCTGCCTGTGCATGGGATTCTATGTTCAAAGCTTTGTTTGGCAGCAGTCCTGTTCTAGAAGTATCGTTTGAAGTGCAAAAGCAGGATTGAGAGGTTCTTTTGGATAATGTGGATCTATCAGGGATGTTCTAGGACTAACATTGTTCTTTTTTTCCT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GTGCAAAAGCAGGATTGAGAGG

60.09

ACCAAAGTCCAGCCAGACAA

59.45

172

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GTGCAAAAGCAGGATTGAGAGG

60.09

AACCAAAGTCCAGCCAGACA

59.45

173

PCR template sequence:

AGAAGTATCGTTTGAAGTGCAAAAGCAGGATTGAGAGGTTCTTTTGGATAATGTGGATCTATCAGGGATGTTCTAGGACTAACATTGTTCTTTTTTTCCTGTGAGAAAACATCATCTTCCTGGTTTTCTTTTCACTATGCTTATAATTTTCTTCATTAAATTTGTTTGTTGTCTGGCTGGACTTTGGTTTCTTCAGATCT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

7

Interacting miRNAs (#binding sites)

mmu-miR-1a-3p(1), mmu-miR-206-3p(1), mmu-miR-34c-5p(1), mmu-miR-298-5p(1), mmu-miR-709(1), mmu-miR-532-5p(1), mmu-miR-3470b(1)

siRNAs for circular RNA silencing
Junction sequence

TTCTTTTTTTCCTGTGAGAAAACATC

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.958935203

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page