top of page

mmu_ciCtnnd1_372

Basic information of circular RNA
PanCircBase ID:

mmu_ciCtnnd1_372

mm39_Chr. Position ID:

chr2|84450806|84451178|-

Gene name:

Ctnnd1

Transcript:

ENSMUST00000099941.9

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

3

Exon/intron offsets:

0

Genomic length:

372

Exon/intron sizes in nt:

372

Flanking exon/introns:

chr2:84450798-84451178

Splice length:

372

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGCTGAGATTTTCGTGTCTTAGAATGATAGGTCCTCTGTGGTATTTTAGTAGAGAAGCTAACGAGTTAAGTGAGCCAAAGCCACTGTCTGCCAGAAAGAAAGTGATGCCTGGGCAAAGAGACAAGGTAAAAGAAGTTCAGGAAGTGGGAAGAGAGGAGGAGTATGACAGTTACAGTAGCTTCCGGAGAGGATGTTAGTGATTGGGCAGTTTTTTTCCATTGAGGGCTTCTGTAGGATGGAGAAGAGATATAGATGACACACACTTCTGTATAAAGACCTAGAGGGTAGGGTTTCTATCTTAGAGTACTGTGGAATTTAAACTTAGATTCTTTATTTCCTCAATAGTTGGTTTTCCTTTTCTTATTCCTT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

AGAGGGTAGGGTTTCTATCTTAGAGT

59.84

ACAGTGGCTTTGGCTCACTT

60.11

180

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

AGGGTAGGGTTTCTATCTTAGAGT

57.64

ACAGTGGCTTTGGCTCACTT

60.11

178

PCR template sequence:

ATAAAGACCTAGAGGGTAGGGTTTCTATCTTAGAGTACTGTGGAATTTAAACTTAGATTCTTTATTTCCTCAATAGTTGGTTTTCCTTTTCTTATTCCTTGTAAGCTGAGATTTTCGTGTCTTAGAATGATAGGTCCTCTGTGGTATTTTAGTAGAGAAGCTAACGAGTTAAGTGAGCCAAAGCCACTGTCTGCCAGAAA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

2

Interacting miRNAs (#binding sites)

mmu-miR-101a-3p(1), mmu-miR-216a-5p(1)

siRNAs for circular RNA silencing
Junction sequence

TTTCTTATTCCTTGTAAGCTGAGATT

siRNA sets

AATCTCAGCTTACAAGGAA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.696698878

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page