top of page

mmu_ciCry2_580

Basic information of circular RNA
PanCircBase ID:

mmu_ciCry2_580

mm39_Chr. Position ID:

chr2|92252642|92253222|-

Gene name:

Cry2

Transcript:

ENSMUST00000090559.12

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

4

Exon/intron offsets:

0

Genomic length:

580

Exon/intron sizes in nt:

580

Flanking exon/introns:

chr2:92252595-92253222

Splice length:

580

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTGAGTGCCCTACAGCACACCACACAGGCCGCTGCTTCCTGTGGGGGACGTGGCCTTCCTGTTTCCTTGTCAAAGTTAGAAAATACTGGCTTAGTGGCTCATGCCTGCAATCCTTGAAACTGAGAGACAGAGGCAGGAGAAATAGGCCAGCCTGGACTACATGAGACCTTGTCTTAAAAAGGAAAAGAAAAACAGAAAAGGTTGCTGTTATCCACCATATGACCAGTTAGTTAACTACCTGTGCCCGGCCAGGCTGCTGCTGTTTGTAGCTGAAGCCTCTTTCTGTAGTTCCCTCTCTCCATCAGTAGAGGCACTGTCTGGTGCTGGTCAGTGGACTTCCTCACTAGGATAACTAATCCAGGCTTTAGGTACCCAGCCCACCTTCCTGCCTCCCTCCTCCTGCCCACACCATCTTCTGATCTGAATAAAGCTAACCTTCTGCACTTTAAGGGTTTTCTCAGTCCTCACAGCACCAAGTCCAAGGTCTGTAGTTCCGTTTAAAGAGCAGATCAGTCTGAATCGTGGAAATTACCATTTTTATATTTGTGAATCATCTTAAAGGTGTTTACTGAGCTGTTTC

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TCCGTTTAAAGAGCAGATCAGTCT

59.78

AAGGAAACAGGAAGGCCACG

60.54

156

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TCCGTTTAAAGAGCAGATCAGTCT

59.78

ACAAGGAAACAGGAAGGCCA

59.44

158

PCR template sequence:

AAGGTCTGTAGTTCCGTTTAAAGAGCAGATCAGTCTGAATCGTGGAAATTACCATTTTTATATTTGTGAATCATCTTAAAGGTGTTTACTGAGCTGTTTCGTGAGTGCCCTACAGCACACCACACAGGCCGCTGCTTCCTGTGGGGGACGTGGCCTTCCTGTTTCCTTGTCAAAGTTAGAAAATACTGGCTTAGTGGCTC

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

6

Interacting miRNAs (#binding sites)

mmu-miR-30e-5p(1), mmu-miR-34a-5p(1), mmu-miR-106b-5p(1), mmu-miR-30a-5p(1), mmu-miR-383-5p(1), mmu-miR-207(1)

siRNAs for circular RNA silencing
Junction sequence

ACTGAGCTGTTTCGTGAGTGCCCTAC

siRNA sets

TAGGGCACTCACGAAACAG,AGGGCACTCACGAAACAGC,ACTCACGAAACAGCTCAGT

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.774528974

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page