top of page

mmu_ciCelsr3_333

Basic information of circular RNA
PanCircBase ID:

mmu_ciCelsr3_333

mm39_Chr. Position ID:

chr9|108718546|108718879|+

Gene name:

Celsr3

Transcript:

ENSMUST00000024238.11

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

20

Exon/intron offsets:

0

Genomic length:

333

Exon/intron sizes in nt:

333

Flanking exon/introns:

chr9:108718546-108718880

Splice length:

333

Other database IDs:

circAtlas: mmu-Celsr3_0001

Human Ortholog IDs:
Mature spliced Sequence:

GTAGGAGCCCCTTTGGTGACTGCTGGGCCAGGGCCTGTCTCCTTATCTCCTAAGGAGCCTGATACCACGTCACCCTCTTACCAACTCTTTCCTTGCTAGACTCCCTCCACCTCATGGTTCCTGTGTGAGACCTTCCCCAGGCCACCTCCGTATTCTTTGCCTTACAAGCGTCAATCCCTTTTCTCTGTTCCTTTCATGGCTCCTGTATCCTCCGCTCCCCAGTTGTTGGGTTTATGTGGAAGAGATCTCTCTGCTTGATGCTGGGTTGGGTTCAGCACTAGGTCCGTGGGTACTTGTTAAGAAGTCACTACAGTTCCTTCCTTTCCTTTGGCA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TTGATGCTGGGTTGGGTTCA

59.81

GTGACGTGGTATCAGGCTCC

60.18

152

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TTGATGCTGGGTTGGGTTCA

59.81

GGTGACGTGGTATCAGGCTC

60.18

153

PCR template sequence:

ATGTGGAAGAGATCTCTCTGCTTGATGCTGGGTTGGGTTCAGCACTAGGTCCGTGGGTACTTGTTAAGAAGTCACTACAGTTCCTTCCTTTCCTTTGGCAGTAGGAGCCCCTTTGGTGACTGCTGGGCCAGGGCCTGTCTCCTTATCTCCTAAGGAGCCTGATACCACGTCACCCTCTTACCAACTCTTTCCTTGCTAGA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

4

Interacting miRNAs (#binding sites)

mmu-miR-541-5p(1), mmu-miR-342-3p(1), mmu-miR-338-3p(1), mmu-miR-7a-2-3p(1)

siRNAs for circular RNA silencing
Junction sequence

CTTTCCTTTGGCAGTAGGAGCCCCTT

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.893947055

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page