top of page

mmu_ciCd53_467

Basic information of circular RNA
PanCircBase ID:

mmu_ciCd53_467

mm39_Chr. Position ID:

chr3|106674774|106675241|-

Gene name:

Cd53

Transcript:

ENSMUST00000038845.10

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

4

Exon/intron offsets:

0

Genomic length:

467

Exon/intron sizes in nt:

467

Flanking exon/introns:

chr3:106674738-106675241

Splice length:

467

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGTTATGAAAACATGACCTCCTCTCTTATTGCTGAGAAGGGGAATACACAGTGGAGAAGTTAGTAAAACCAAACCAGTACTAAGTTATACAAATGAAGTAAGAGAATGAGAGATCAACTGCAATTGAGAGAAAAAATGTCATGAAGATTATATTTGAATGATGCCTTAAAGAGAAGATGAAGCAAGTTTGTCTTCTTCTTGGCCATGTTTCTCTGTGTTTCTGCTAGTCTTCTCAGTAATGTATAACCTTGGCTTTGGTTGTTTAACTTTTTTCTTTGTAAAACTATAGTTCTGGAAGGGTAAAAGTCAATTATGTATATCTTCCTTAGATCCCACATAATCCTCAGCTTCTCTTCTTATATAATCTCCCAAACCCCATTTTCATAGCTCTAACTCCTTGATGAGGATGGGGCATCAATTTGGTCTACTAGAATTTTCTTATTTCTTGAATTCGTCTTGTTTTT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TCTCCCAAACCCCATTTTCA

56.92

CTGTGTATTCCCCTTCTCAGCA

59.76

154

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TCTCCCAAACCCCATTTTCA

56.92

ACTGTGTATTCCCCTTCTCAGC

59.76

155

PCR template sequence:

TCTCCCAAACCCCATTTTCATAGCTCTAACTCCTTGATGAGGATGGGGCATCAATTTGGTCTACTAGAATTTTCTTATTTCTTGAATTCGTCTTGTTTTTGTAAGTTATGAAAACATGACCTCCTCTCTTATTGCTGAGAAGGGGAATACACAGTGGAGAAGTTAGTAAAACCAAACCAGTACTAAGTTATACAAATGAA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

2

Interacting miRNAs (#binding sites)

mmu-miR-494-3p(1), mmu-miR-207(1)

siRNAs for circular RNA silencing
Junction sequence

TCGTCTTGTTTTTGTAAGTTATGAAA

siRNA sets

ATAACTTACAAAAACAAGA, AACTTACAAAAACAAGACG, TAACTTACAAAAACAAGAC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.824446915

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page