top of page

mmu_ciCbr2_105

Basic information of circular RNA
PanCircBase ID:

mmu_ciCbr2_105

mm39_Chr. Position ID:

chr11|120622641|120622746|-

Gene name:

Cbr2

Transcript:

ENSMUST00000026148.9

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

1

Exon/intron offsets:

0

Genomic length:

105

Exon/intron sizes in nt:

105

Flanking exon/introns:

chr11:120621929-120622746

Splice length:

105

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTGAGTGTGAGCGGGGAAGGGGATGAGTGTGAGCAGGGGAATGAGGTGAGTGTGAGCCGAGAAGTGAGGTGAGTGTGAGCAAGGAAGTGAGGTATGAGTGGGGAA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GAGCCGAGAAGTGAGGTGAG

59.83

GCTCACACTCATCCCCTTCC

60.11

86

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GAGCCGAGAAGTGAGGTGAG

59.83

CTCACCTCATTCCCCTGCTC

59.82

102

PCR template sequence:

GAGCCGAGAAGTGAGGTGAGTGTGAGCAAGGAAGTGAGGTATGAGTGGGGAAGTGAGTGTGAGCGGGGAAGGGGATGAGTGTGAGCAGGGGAATGAGGTGAGTG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

1

Interacting miRNAs (#binding sites)

mmu-miR-342-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TATGAGTGGGGAAGTGAGTGTGAGCG

siRNA sets

TCACACTCACTTCCCCACT, CACACTCACTTCCCCACTC, ACACTCACTTCCCCACTCA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CICBR2_105_ORF_1

0.8861

0.279361369

0.135654643

84

ORF sequence:

ATGAGTGGGGAAGTGAGTGTGAGCGGGGAAGGGGATGAGTGTGAGCAGGGGAATGAGGTGAGTGTGAGCCGAGAAGTGAGGTGA

Peptide sequence:

MSGEVSVSGEGDECEQGNEVSVSREVR

IRESfinder result

IRESfinder score

0.273343595

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page