top of page

mmu_ciCacna1b_333

Basic information of circular RNA
PanCircBase ID:

mmu_ciCacna1b_333

mm39_Chr. Position ID:

chr2|24538575|24538908|-

Gene name:

Cacna1b

Transcript:

ENSMUST00000070864.14

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

30

Exon/intron offsets:

0

Genomic length:

333

Exon/intron sizes in nt:

333

Flanking exon/introns:

chr2:24538574-24538908

Splice length:

333

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTATGTGCCTCAGCTTGCTCTTTGCTTTGTGATGAGCTACATTCTGGCATCCTTCCCTGTTTTTGAATGGCCTGTGCAGCACTTATGATACTGTGAGCGTCCCGAGGAAGAGCTGCTTTGCTCTCAGTTGCTTGAGTCTTGCCCTGCCTTGGGCCGGAAGGCCTGCAAGCCTGAGATTCCCCTTTCTGCACCTTTAGCTCTCAGTTATGCCTTTCCCCAGACTGGAAGTATTTGCATGCCTGCTGTGACATCTGCTTCTCATTGGCCTTGTGTTAAGCATCGATCACCTTTGCCCAGGGAAGCCATCAGCACTGACTGCCCTCTTTTTCTCTA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

ATCGATCACCTTTGCCCAGG

60.11

ATAAGTGCTGCACAGGCCAT

60.03

141

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

ATCGATCACCTTTGCCCAGG

60.11

TAAGTGCTGCACAGGCCATT

60.25

140

PCR template sequence:

GCATGCCTGCTGTGACATCTGCTTCTCATTGGCCTTGTGTTAAGCATCGATCACCTTTGCCCAGGGAAGCCATCAGCACTGACTGCCCTCTTTTTCTCTAGTATGTGCCTCAGCTTGCTCTTTGCTTTGTGATGAGCTACATTCTGGCATCCTTCCCTGTTTTTGAATGGCCTGTGCAGCACTTATGATACTGTGAGCGT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

8

Interacting miRNAs (#binding sites)

mmu-miR-27b-3p(1), mmu-miR-27a-3p(1), mmu-miR-31-5p(1), mmu-miR-18a-5p(1), mmu-miR-216a-5p(1), mmu-miR-214-3p(1), mmu-miR-467b-5p(1), mmu-miR-350-3p(1)

siRNAs for circular RNA silencing
Junction sequence

CTCTTTTTCTCTAGTATGTGCCTCAG

siRNA sets

ACATACTAGAGAAAAAGAG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

CICACNA1B_333_ORF_1

0.7996

-0.235456854

0.017636761

99

ORF sequence:

ATGCCTGCTGTGACATCTGCTTCTCATTGGCCTTGTGTTAAGCATCGATCACCTTTGCCCAGGGAAGCCATCAGCACTGACTGCCCTCTTTTTCTCTAG

Peptide sequence:

MPAVTSASHWPCVKHRSPLPREAISTDCPLFL

IRESfinder result

IRESfinder score

0.814523957

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page