top of page

mmu_ciBrd8_1453

Basic information of circular RNA
PanCircBase ID:

mmu_ciBrd8_1453

mm39_Chr. Position ID:

chr18|34733802|34735255|-

Gene name:

Brd8

Transcript:

ENSMUST00000003876.10

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

21

Exon/intron offsets:

0

Genomic length:

1453

Exon/intron sizes in nt:

1453

Flanking exon/introns:

chr18:34733294-34735255

Splice length:

1453

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGTATTGAATGGCTGCAAGTGGTGATGTTGCCAGAAAGATTCTCAGCTCCTGCTGGGCCTGGGTGACAGAGGGAAATCCAACATGCAGACTGTGGCAATGTCTTGAAGTTCTTTTTTTATCCATTGAATAGGAAACTCTTTGTCTTCTGCATTCTGGTCTCTTTGCTTGTGTGAGTGTGGCGGGGTTGGGAGGGGCAACTTTCAAGATCACTGGATTGGACTATGAAATATTCTTGGGGTAAAGACCTAGGATGCACCTGCTCCTCATTTCTTGCTTCCACTTTTTACCAATTCTTAACTTACAATGGAAGACAGCTCAGAGCAGCAAGGGCAGGTGAGATGATACAGTGGGTACAGGCACTTGCCATGGTAGTCTGCTGACCTGAGTTTGATTCCCAGTACCCCACTGAAGGTAGAAGAAGAATGCTCCACAGAGGTGTCCTCTGAACTCCACATGTGCACCATGGCATGTGTGCTCCCATACATATGCCACATACAATAATAGTGACCACCAGATACAATAATAGCTTATGGATTATAGATAAACACAATAGATCTAGCCCCAAGGCTTTTGTTTGTTTATTCCATGAGTTAAAAGACTGACCTTGTTCATGGTAGAGCAATGAAGTGAGGGAAAGACCTTGCTCAAAAACTATGGTTCTACGATCACTGGATAACCTTTGAGAGCCTTAATTTTCCATCTATGTGATAGAAGTAACTATGAGTTGAAAGGCAGGAGAATTGCCTGCAGAATCAATGCATACGTAGTACACAGAGTAAGACCTTGTCTCAAAAGAAAACATGTGGGAATACTAGAGAGGTGACCCAGCAGTTAAGAACGCTTGCTGCTCTGAGAAGATCTGGGTTGGGTTTCCAACAACCACCTGGTGGCTTACAACTGCCTGTAATTCCAGTTTTAAGGAATCCAAGGCCCTTTTCTGGCCCTCACAGGCACTGTACACTTGTGGTGCACATATACACATGTAGGCCAAACATTCGTACATATAAAATGAAAACAAGTCTTTAAAACAAAAAAAAAGAATAATTGAAAAAAAAAGAGTAAGATTGAGATACCTGTCCAGCCTACCTCACAGGGATGTTGTGAGGGTAAAATAAGTTATGAAACTAACTTGAAAACAAATTAAAATCTTACACAAATGCAAGGTGTTATTTCTATTCTTACTGTTGGCTATTGGCAACTTGTGTTCTAAAATTTTTTAATCCTTGCATATTAGAAATGCAAAACTGGTCTGGTCCAGCAAAAGTGTTCACTAGTTCATCTTGCCTGTAGAGCTGTACCACGGGCAGAAGAACACCGTGATCTCTGTTCTTTCTTATTGGCCTGCAACAGTGACTGGATCCTCATTCGAGTGGCTGGCTATTGCAAGGCTGGTTAATAGGATCTTGTATCTATCGAAGACAGCAGAGTTTTGCACAAGAGGAAGGATCT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TGGCTATTGCAAGGCTGGTT

60.25

GCCACAGTCTGCATGTTGGA

60.89

174

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TGGCTATTGCAAGGCTGGTT

60.25

GGATTTCCCTCTGTCACCCA

59.01

157

PCR template sequence:

GTGACTGGATCCTCATTCGAGTGGCTGGCTATTGCAAGGCTGGTTAATAGGATCTTGTATCTATCGAAGACAGCAGAGTTTTGCACAAGAGGAAGGATCTGTAAGTATTGAATGGCTGCAAGTGGTGATGTTGCCAGAAAGATTCTCAGCTCCTGCTGGGCCTGGGTGACAGAGGGAAATCCAACATGCAGACTGTGGCA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

18

Interacting miRNAs (#binding sites)

mmu-miR-297a-5p(2), mmu-let-7a-5p(1), mmu-let-7e-5p(1), mmu-miR-150-5p(1), mmu-miR-31-5p(1), mmu-miR-19b-3p(1), mmu-miR-211-5p(1), mmu-miR-204-5p(1), mmu-miR-33-5p(1), mmu-miR-19a-3p(1), mmu-miR-495-3p(1), mmu-miR-214-3p(1), mmu-let-7d-5p(1), mmu-miR-224-5p(1), mmu-miR-342-3p(1), mmu-miR-377-3p(1), mmu-miR-466a-5p(1), mmu-miR-188-3p(1)

siRNAs for circular RNA silencing
Junction sequence

AGAGGAAGGATCTGTAAGTATTGAAT

siRNA sets

ATTCAATACTTACAGATCC, ATACTTACAGATCCTTCCT, AATACTTACAGATCCTTCC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.75905364

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page