top of page

mmu_ciAtp7a_500

Basic information of circular RNA
PanCircBase ID:

mmu_ciAtp7a_500

mm39_Chr. Position ID:

chrX|105140459|105140959|+

Gene name:

Atp7a

Transcript:

ENSMUST00000113557.8

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

8

Exon/intron offsets:

0

Genomic length:

500

Exon/intron sizes in nt:

500

Flanking exon/introns:

chrX:105140459-105140995

Splice length:

500

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGTACTTTGGGGTTATCAATAAAAACATTTCAACTCCTTTTAGAAATTTAACATCCTGTTAGCATGTCAATTTGTACTATAGCATTTTTTATCCTTTTAGAATTTTAACATCCTGCAAGCATGTCAATTTGTACTATAGCACTTTTTATCCTTTTAGAATTTTAACATCCTGCAAGCATATTAATTTGTACTATAACATTTTTTAAGATTTACTTTGATATTTTCAATTTTGTGTGTATGTGTATGTGAGTGGCTATCACATGTATGCAGGAGACTGTGGAGGTCAGAAGAGGGTGTTAGATCTGCTGCTACTGGAGTTATGGGTGTTTGTGAGCTGATGTGCGTGCTGGGAACTAAACTTGGGTCCTCTGAAACAGCAGTAGGAGCTTGTAACTACAAAGCCATTGCTCCAACTACATGCTATCTTCTTAGCCTGAGTGAGATGGTTTCTCTATAGTTCATAGAATATTTAACTTTTAGGTACTCACTAACTAAAA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GCCATTGCTCCAACTACATGC

60.2

ACAAATTGACATGCTAACAGGA

56.26

175

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GCCATTGCTCCAACTACATGC

60.2

AGTACAAATTGACATGCTAACAGGA

58.76

178

PCR template sequence:

AAAGCCATTGCTCCAACTACATGCTATCTTCTTAGCCTGAGTGAGATGGTTTCTCTATAGTTCATAGAATATTTAACTTTTAGGTACTCACTAACTAAAAGTAAGTACTTTGGGGTTATCAATAAAAACATTTCAACTCCTTTTAGAAATTTAACATCCTGTTAGCATGTCAATTTGTACTATAGCATTTTTTATCCTTT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

16

Interacting miRNAs (#binding sites)

mmu-miR-20b-5p(2), mmu-miR-106a-5p(2), mmu-miR-93-5p(2), mmu-miR-20a-5p(2), mmu-miR-17-5p(2), mmu-miR-15a-5p(1), mmu-miR-135a-5p(1), mmu-miR-15b-5p(1), mmu-miR-106b-5p(1), mmu-miR-18a-5p(1), mmu-miR-203-3p(1), mmu-miR-466d-3p(1), mmu-miR-325-3p(1), mmu-miR-452-3p(1), mmu-miR-466b-3p(1), mmu-miR-350-3p(1)

siRNAs for circular RNA silencing
Junction sequence

TCACTAACTAAAAGTAAGTACTTTGG

siRNA sets

CAAAGTACTTACTTTTAGT, AGTACTTACTTTTAGTTAG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.890353095

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page