top of page

mmu_ciArih1_3982

Basic information of circular RNA
PanCircBase ID:

mmu_ciArih1_3982

mm39_Chr. Position ID:

chr9|59315725|59319707|-

Gene name:

Arih1

Transcript:

ENSMUST00000171975.8

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

7

Exon/intron offsets:

0

Genomic length:

3982

Exon/intron sizes in nt:

3982

Flanking exon/introns:

chr9:59315700-59319707

Splice length:

3982

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGAAAGTGATTTCCTAGACGAGGGAAGTTAATATAGGGTTTCTTCTACCTTTTCTTTTTAATCTTGATAATAAAACGGGAAACTTCATGCTGGGAAATAAATGATACTAGTTAAAAGTAGTGTGTATTTCTTTTAAGTAAGACACAAATCACACCTTAAGTTTTGTTCTTTCCCTAATGCTTTTATATTTTGGAGCATTGTGCATGTATATGATAGTGTGGGGGTGGGGTGTTTTGTTTAAGGCAGCCCAAACTGACCTCAAACTCACATTAATCCCTGCTCAGTGTCCCAAGTGCTGGGATAAGCATGTGCCATCATACCAGCTGAATGTATTGTTCATTGGGGGAAAATGATGCAATAATTATAATTTTCTTTATATTTCACTTTAACCTTTAATTAGAGGAAACAATCTGGGTTAATTGCCTTTTTTCAACATTCAGAAAGTGTCTGTGTCTGTCTGTGTGTGACGTTTTCTTGGGAGAGCTGTCCCTTATACATGCTTGATGAGTGTGTGGTGGTGTCTTGGGGAGCAAACTCCTGTCAAAGCTTAATGGCAGTGCTGAGCTACCCAAATTGCTGCTTGTTTTACTGTGTTTTGTTTCATCTGGCTCCTGCTGTCTTCCTTGTCACAGATTAAGAAGTAAAGACTATGTGGCTTACTTGAAAATAATAAATTTCCTTGATTTAGACAGAGTTTTAATCTAACAAGAAGAAAATATGTAGGTAATTTTGGTTGTTTAGGTCATCTGTCCTGATAACATGGGACTTTAGAATTCTATAGTACAGGCTTCTGTCTAAGCAGTAGATGTCATTTAATCAGGAAATTTTCAACACCAAATATTGGGGAACATCTCAGTGTCTCTGAAGTGTTTTATTGGCTTTTTTTTCTCTAAATGGGTAGATAGCCTGAGAATTTCTCAATTTGAAAGTTTTTGTTAAAAATTTATGAGCTAATTAAAATTAATTAAAGTGTTAAGAAAAAAATAAATAAATATAGATAGCTTTGAAAACAAAAAAAAAAAGAAAGTTTTTGTTTCTTTTTTTTACATCCAAGAGCCCAACTGTATCTTCAACCAATGTTTATTCAGTCATATATTCACTTCATTGCTTGTCCATCTCTACCACTGAGTAAAACAGTATGGTACAAATAGTTAATTAAGTCAGGTTCTACTTTTTACAGTGAATAGTTGTCCTCGAGTTTGCAATAACATCATCTTCATTTTCATCAGACATCCCCAGAATGACTTTTCTTGGCCTTAGCTCCATACACCTTTTCTTTAGGACTGCTCTGTACTCTCAAGATGACTGAGACTGTCTCTACACTTCTTTTTTTCATTATCAAGTCTCATGACAGCCAATATCTCTTTGTCTGTCTATTCAATGTAATATATTTCTTTCTAACACACATCCCAACCACTATTACTGTGTTCCAAATCTGCTTCATCATTTTAGGCTCACTTCTCATCAGCAGTTTCCTTTCTTAGCCTGGTAAGCTGCTATAACAAAATACCAAGATTGTCTAGTATTTACATGGCAAGAATTTATTTTGCAAGCTGGGACGTCCTGCATCAATGTGCCGGTGATTGCTTATGTTGGTTAAGTTTACTTTTTGCTATATAGAGGATACCTTGTGAATAATCTCACATAGTAGAAGGAACAAGGCCTCAGTCTTCATTTCTTTGATCATGAATGCAGTCCTCATGCCATAATTACCTTACAGATGTTCCTAATATGTGTGTGTTGGGTGAAACAGGTGGGTGTGGTTTTTTTTTTTTTTTTTTTTTTTTTTTGAGAGAGGAATCTCTTCTACATTAACCCTGGCTGTCGTAAAACTCATTAGTAGATTACACTGGCCTCTTGAAGTGCTAGGATAAAAGGTGTACGCCATCATGCCCAACAACCCCTGCCTTTTAATGCCATCTCACTGGTGATTAGATTTCAACATTAGAATCAGATTTGGGAACACGCAGGATCTAGCAGAAAGGTAAATGATCATACAATCTTTTAAAGAAAAGGAGCCACATAGAGCAACTAGATAGATGTTTTGCTGGTATTCTAATACTGTTCTGATTCTTTAAAAACAGCCATAGAAGTAATAAATATCCAAATTGTTAGATAAATAACCAAAATAATTAATACCCAAAGAGCAAATAAATTCACTAATTTGTAAGCACATATAAAATACAAATTGTATTGATAAAGATCAATAGTGTGTTAGTATTTTAGAGTTTAACCTTGTGATCTAGACAGACTGGTCAGTAAAGTGTTTGCAAGAGTAAAAACTTGAGTTCTAGAACCACTCAAAGCCAGGCACGCTAACATGCACTACATAACTCCATGTGTTCCTGTGGTGACATAGGAAGCAAAACCAAGAGAATCACTGGGAGTTTGTGAACAGTAACAAAGGGAAGAGAGACCCTGTTTCAAACAAGGTCAAAGATGAGGAAATTCACTGTCTTCCAACTTGTTTTACTATAGCACACATGTGCCTGCCACCACACATAAAATTTACCTTTTTTTCTTTTTGGTTTTTTTTGGTTGGTTGGTTGGTTTTTCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCACCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGTGCCACCACCGCCTGGCTAAAATCTACCTTTGTAACAAGATGAGAAGGTGAAATATATTCCACACCTGCTTTCAAATTTATTTTTAAATAAAAAAATGTAAAGATTTATTTAATATAGATTTACTTATGTGTATGAGTGTTTTTCTTGTTTGTATACCACACACATTCAGTGTCCTCAGAGACCAAAAGAGGGAATCAGATCTCCTTTAACTGGAGTTAGAAATGATTGTTAACCACCATGTGGTGCCTGCAGTCAAGCCTGGGTCCTCTATAACAGCAACAAATGCTATTCCTGAGCCATGTGTCTTGTTGTTAGGAAATGGCTGTGGAATACGCTTGAAGCTCCTCACTTCCCTGTTCTGTCACATTCCCTGTGTCTACCTTGTTAGAGGAAAGTCATCTCCTTGACTTCATTTAATCACTAATTTCACTTTGTATGAGTTCTATTAAATTTGTTGACAGCTCCATACACATGGAGTGCATTCTGATTGCTCTTGTCCTTTACCACTGCAGCCCTACAGATCCCACATTCATATCTTACTCTGTGACTCACCGACTTCACTGTGTGGTTCACTATTAGTTTGGGCTCCTTACAGTGAGTCTTCCCCTGACCACCATTTTGAGACAAGGTGTTATGTGACCTTTAACTCCCCATTTTCCCTCTCTTGAGGCCTAGATTCAGTAGCTACCCTGCCCATAAGCCATAAGCATTTATTTTTCCTTCATTTATGCCCTTTGAATGGAATATATATATATGTCTGTGTGCGCATACACACACACACATACACACATACATGCTTAGTGCTGGAATTACAGGTATGAGCCACAATGCCTGGTTTTTTTTTTTGGTTGGGGGAGGGGAGAGCTTGCCTTATTTGGCTTTGAATAGATTGGTTAATACTATTTCTCTCTGTGGAGCTGAGTTTAATCTGTTCACATTATTCAAGGGCTTGTCTCTTTGTTTCTAATGTATTGTTTACTGTATATATTATGGAGTTGTGAATTAATCAGCTAGTTGGAGTACAGAGTGAATGAAGACTATATATCAATGAAGCGTTACCACAAACTTCTCAGTGCAATCTGAGCGAGTCAAGCAAAGCTTACTGTATATTGTATTATATAATTGTTGTACTACTACACACTAATTCTTTAAAAAAAATCACTAAAATAAACAGACACATTCCTTGATTTGGTATTTCTCAATAATATAGACCTTGCTGACAGTACTGGGGAACTGTAGAGTGTGAAATGGTTGTTTTTTTTGTTTGTGTGTGTGTTTAAAGTTATACTAAATAGGATTAATTA

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

ACTGGGGAACTGTAGAGTGTG

59.03

TCCCAGCATGAAGTTTCCCG

60.32

178

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

CTGGGGAACTGTAGAGTGTGA

58.75

TCCCAGCATGAAGTTTCCCG

60.32

177

PCR template sequence:

ATATAGACCTTGCTGACAGTACTGGGGAACTGTAGAGTGTGAAATGGTTGTTTTTTTTGTTTGTGTGTGTGTTTAAAGTTATACTAAATAGGATTAATTAGTAAGAAAGTGATTTCCTAGACGAGGGAAGTTAATATAGGGTTTCTTCTACCTTTTCTTTTTAATCTTGATAATAAAACGGGAAACTTCATGCTGGGAAA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

41

Interacting miRNAs (#binding sites)

mmu-miR-466a-5p(5), mmu-miR-466p-5p(4), mmu-miR-1187(3), mmu-miR-297a-5p(2), mmu-miR-9-5p(1), mmu-miR-140-5p(1), mmu-miR-1a-3p(1), mmu-miR-32-5p(1), mmu-miR-199a-5p(1), mmu-miR-7b-5p(1), mmu-miR-206-3p(1), mmu-miR-181a-5p(1), mmu-miR-223-3p(1), mmu-miR-26a-5p(1), mmu-miR-211-5p(1), mmu-miR-204-5p(1), mmu-miR-322-5p(1), mmu-miR-335-5p(1), mmu-miR-298-5p(1), mmu-miR-217-5p(1), mmu-miR-7a-5p(1), mmu-miR-709(1), mmu-miR-339-5p(1), mmu-miR-181b-5p(1), mmu-miR-214-3p(1), mmu-miR-128-3p(1), mmu-miR-26b-5p(1), mmu-miR-541-5p(1), mmu-miR-340-5p(1), mmu-miR-325-3p(1), mmu-miR-377-3p(1), mmu-miR-539-5p(1), mmu-miR-484(1), mmu-miR-452-3p(1), mmu-miR-3065-5p(1), mmu-miR-3470b(1), mmu-miR-3105-3p(1), mmu-miR-574-5p(1), mmu-miR-544-5p(1), mmu-miR-338-3p(1), mmu-miR-181d-5p(1)

siRNAs for circular RNA silencing
Junction sequence

ATAGGATTAATTAGTAAGAAAGTGAT

siRNA sets

TTTCTTACTAATTAATCCT, CTTTCTTACTAATTAATCC, ACTTTCTTACTAATTAATC

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.920118223

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page