top of page

mmu_ciArap2_629

Basic information of circular RNA
PanCircBase ID:

mmu_ciArap2_629

mm39_Chr. Position ID:

chr5|62826593|62827222|-

Gene name:

Arap2

Transcript:

ENSMUST00000076623.8

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

17

Exon/intron offsets:

0

Genomic length:

629

Exon/intron sizes in nt:

629

Flanking exon/introns:

chr5:62826568-62827222

Splice length:

629

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTATTTAAATTTTATATCTGCTTAGTCCAGGAAAGATCTTTAACTTGTGATCTATAGTTGAGGTTCAAAGCTCCGTGAACACCTTACCTTTAGTTCTAGGATGAAAGTTTTCCATACTTTCAAAGTCGGCCATCAAAAACTGTTAAAAGCAGATTTTCTAGGGCCTGAAACAGACAAGAAATCAATGTGTCACATTAGCAAAAATTATTCTTGCAAGCAAATTCTCAACTTTTGATGATTAAGGTAGTCTTCATGCTGTAAAGACATTTTTTTTCTCCTGTGCCTTCTCCTGGGTATGTCACCTACCCGTGTACAGGAGGAAAGGAGCAGAGTCAGGCAGCCATGCGAAAGGAGCACACACTGAATGGAAGTTCAGAAGCTAAACTTCTAAAAGATCTCACGAACCAAGAAAGAACATTTCCCATTTCGTATACATACTACAAAAGCAAAGCCTTTAGTGTTGCTGCCTGAAAACATACATGACCTGTTTGCCTTAAGTCTCATGGCATTTTAAACTAATTATATTGATCTTGTCAATTCCTTGGAGTCTTTAGAAAACGAAGATAATTTTTCCCGTTTCCCTCTGTCTGTAGCTAGAGAAGGGCTTTCCTATTGTCACTGTCTTTCTT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TCCCGTTTCCCTCTGTCTGT

60.47

GGTAAGGTGTTCACGGAGCT

59.68

146

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TCCCGTTTCCCTCTGTCTGT

60.47

AGGTAAGGTGTTCACGGAGC

59.68

147

PCR template sequence:

CTTGTCAATTCCTTGGAGTCTTTAGAAAACGAAGATAATTTTTCCCGTTTCCCTCTGTCTGTAGCTAGAGAAGGGCTTTCCTATTGTCACTGTCTTTCTTGTATTTAAATTTTATATCTGCTTAGTCCAGGAAAGATCTTTAACTTGTGATCTATAGTTGAGGTTCAAAGCTCCGTGAACACCTTACCTTTAGTTCTAGG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

5

Interacting miRNAs (#binding sites)

mmu-miR-124-3p(1), mmu-miR-15a-5p(1), mmu-miR-434-3p(1), mmu-miR-297a-5p(1), mmu-miR-539-5p(1)

siRNAs for circular RNA silencing
Junction sequence

CACTGTCTTTCTTGTATTTAAATTTT

siRNA sets

AATTTAAATACAAGAAAGA, AAATACAAGAAAGACAGTG, AAATTTAAATACAAGAAAG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.840276112

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page