top of page

mmu_ciAnkzf1_42

Basic information of circular RNA
PanCircBase ID:

mmu_ciAnkzf1_42

mm39_Chr. Position ID:

chr1|75170928|75170970|+

Gene name:

Ankzf1

Transcript:

ENSMUST00000151887.9

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

1

Exon/intron offsets:

0

Genomic length:

42

Exon/intron sizes in nt:

42

Flanking exon/introns:

chr1:75170928-75171484

Splice length:

42

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAAAGGCCAGCAGATGAGGTTAGATGGTAGAAGCAGAAGT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

NA

NA

NA

NA

NA

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

NA

NA

NA

NA

NA

PCR template sequence:

TTAGATGGTAGAAGCAGAAGTGTAAAAGGCCAGCAGATGAGG

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

NA

Interacting miRNAs (#binding sites)

NA

siRNAs for circular RNA silencing
Junction sequence

TAGAAGCAGAAGTGTAAAAGGCCAGC

siRNA sets

TGGCCTTTTACACTTCTGC, CTGGCCTTTTACACTTCTG, TTTTACACTTCTGCTTCTA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.099825225

IRES/non IRES

non-IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page