top of page

mmu_ciAnkib1_251

Basic information of circular RNA
PanCircBase ID:

mmu_ciAnkib1_251

mm39_Chr. Position ID:

chr5|3743520|3743771|-

Gene name:

Ankib1

Transcript:

ENSMUST00000043551.11

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

19

Exon/intron offsets:

0

Genomic length:

251

Exon/intron sizes in nt:

251

Flanking exon/introns:

chr5:3743496-3743771

Splice length:

251

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAGTCTCGCTGGCGGCTGGGCACCATGCCATGCCTCCGCTTCTCTGTCTAGTTGTTTCTTTCGCTGGTTTCCTTTTTCTCCTTTCTGTGGTAGAAGTTTTGTTTCAGTGGTCAATAGGGTACAGAGGGGTTCTTGTACTTAAGATTTATAAGGCAAGGAGAAAATTGTAAGATTTAAATATGTAAAATAACTTACAGAGATGGGTAAATGTGATTGGATTAAATAATTTTTCTTTAGTCCCATTTTAAAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

AGGCAAGGAGAAAATTGTAAGA

55.62

TAGACAGAGAAGCGGAGGCA

60.32

151

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

AGGCAAGGAGAAAATTGTAAGA

55.62

CTAGACAGAGAAGCGGAGGC

59.62

152

PCR template sequence:

AGGCAAGGAGAAAATTGTAAGATTTAAATATGTAAAATAACTTACAGAGATGGGTAAATGTGATTGGATTAAATAATTTTTCTTTAGTCCCATTTTAAAGGTAGTCTCGCTGGCGGCTGGGCACCATGCCATGCCTCCGCTTCTCTGTCTAGTTGTTTCTTTCGCTGGTTTCCTTTTTCTCCTTTCTGTGGTAGAAGTTT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

NA

Interacting miRNAs (#binding sites)

NA

siRNAs for circular RNA silencing
Junction sequence

TCCCATTTTAAAGGTAGTCTCGCTGG

siRNA sets

GAGACTACCTTTAAAATGG,GACTACCTTTAAAATGGGA,AGACTACCTTTAAAATGGG

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.909391639

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page