top of page

mmu_ciAnapc5_820

Basic information of circular RNA
PanCircBase ID:

mmu_ciAnapc5_820

mm39_Chr. Position ID:

chr5|122956096|122956916|-

Gene name:

Anapc5

Transcript:

ENSMUST00000086216.9

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

3

Exon/intron offsets:

0

Genomic length:

820

Exon/intron sizes in nt:

820

Flanking exon/introns:

chr5:122956067-122956916

Splice length:

820

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTATGGAACTTCTCCGGAGAGCAGGGAGCGTTCCCATTGAAGTGAGCGGCGTTCTGAGGGGCATCTGTCCTGACTTGGGTGTACAGAAGCAAGCAGACTAGGGTGCTGGCTGTGTGCGGTTTGTATTCACTGCCTTCCTGTTTCGTTCTCTATTCGACCGTAACCTGTGGGGAGGCAGCTCTGTTCTCCTGGAGTAGTTAGCCTGGGCCTGGGGTCTTTAGGGTCGCTCAGCTCTTTTCACAGTCCTGCGGACCACTTGACTGGGTTGTGCCAACTGTAAGTGGGGTCACCAGCCACACTTAGGAAGCGAGGTGAGTGGAGACCGCTCTTAAGCTTTAGTGTTGAAGCGCGTGTGCACGTGACATTTCTTTGATGCTTTTGTACTAACTGTGTCCCGTGGGCCCCCCCACCCCCACACTCTGTTGCATGGTCATTTTTATGTTAGTCGACATCAGTTGGTTATTGATCTCCTGTCCCCAGGTCATGGATGTACAAGGTAGACATAGCCTTGCCTCTGACAGAGACAGGTGTGCTGGAAGGAGGGATGGCAGATGTTCAAAGGGAAATCAGTAAATAAGATAACATAATTACACCTCAGCTTTTGACTAGACTCACATACAATAACTATGGTAGCTTCAGAGAGTTTGAATAGCCGTGAGGAAAATGGAGGCCTGAAGGGCTAGAGGTGGGAGAGGCCTGAGACCTGAATGGAGGGAGAGCATGCGGGAAGAGCACTGGAGGAGGAGGGACAGCACCTCTGATTCCTCTGAGGGGAATGGGGCTGGAAGTTGTTGTGAGTCTTGGGCTATCAGCTAATGCT

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

GGGACAGCACCTCTGATTCC

60.11

GGACAGATGCCCCTCAGAAC

60.11

145

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

GGGACAGCACCTCTGATTCC

60.11

AGGACAGATGCCCCTCAGAA

60.25

146

PCR template sequence:

ATGCGGGAAGAGCACTGGAGGAGGAGGGACAGCACCTCTGATTCCTCTGAGGGGAATGGGGCTGGAAGTTGTTGTGAGTCTTGGGCTATCAGCTAATGCTGTATGGAACTTCTCCGGAGAGCAGGGAGCGTTCCCATTGAAGTGAGCGGCGTTCTGAGGGGCATCTGTCCTGACTTGGGTGTACAGAAGCAAGCAGACTA

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

11

Interacting miRNAs (#binding sites)

mmu-miR-211-5p(1), mmu-miR-204-5p(1), mmu-miR-335-5p(1), mmu-miR-298-5p(1), mmu-miR-320-3p(1), mmu-miR-136-5p(1), mmu-miR-96-5p(1), mmu-miR-34b-5p(1), mmu-miR-297a-5p(1), mmu-miR-207(1), mmu-miR-574-5p(1)

siRNAs for circular RNA silencing
Junction sequence

ATCAGCTAATGCTGTATGGAACTTCT

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.646787586

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page