top of page

mmu_ciAbce1_1103

Basic information of circular RNA
PanCircBase ID:

mmu_ciAbce1_1103

mm39_Chr. Position ID:

chr8|80433948|80435051|-

Gene name:

Abce1

Transcript:

ENSMUST00000080536.8

CircRNA type:

Circular intronic (ci)RNA

Exon/Intron count:

1

Exon/intron indexes:

2

Exon/intron offsets:

0

Genomic length:

1103

Exon/intron sizes in nt:

1103

Flanking exon/introns:

chr8:80433948-80435051

Splice length:

1103

Other database IDs:

Human Ortholog IDs:
Mature spliced Sequence:

GTAAGTGGCTCTGTCGGCATCCAAGAGTAGAAAGCAGCTGTAGAAGAGCAGATGGGTTTGGAAGCTTCCTAGGGGCTTAGCAGATACTGTGATAGTTAATCACTGGTGGTTTCTTTGAGCTACAAAAGTGAGAAATTTAGAATTCTAAACTTTTATTGATTTTAAATTATCCTTTTGAAAGGAATTATAGAATGTAATTGTTAAGATTGTAAAAAGTCAAGCCAAAGTTCACTGTACTCCTTGCAGTCCTGCAGATAGGTGAGTCAAGGGGAAGGATTGCCAGGGTCCTTCCATTAGATGTTGTTTTAAGACAGACATTTTGTGGGGTATTGCTAGGTTTTCAGGATGGAGTAAATGTAACAATTCAGAGGTGACAAGTTGTTGACCGTCTTCAGTGTTATGTTACATGACTGCTGCCCCGTAGTAGTGACCTTCTAGACTTACCAAGTCGGAAGAGAACCTGTAGGTATTATCTGTTAGTATCTCCCATGGTTTTCAGAAATTCAGTCATTAATGTCTCAAATACTGTACTGAATTTTGTCTGTGTACTAGAAAAAAGCATAGCTTTTTATGGTTTCATTTACCTCACTGAAATAATTTATTCCTTTCTATGGTGTGCCTTTCATTGCTAAGACATGCTTTCTTTGGGAGGGGGGTGTTGGTTTTTTTCAAGTAGCCCTGGCTGTCCTGGAACTAACTCTGTAGAGCAGGCTGGCCTCTGCCTCCCAAGTGCTGGGATCAAAGGCATGTGCCACCACTGCCTGGTGACATGATTTCTTTTATAAGGCAGCTAGTGAATGCATAGCTCCAGTTGCATCCAAAGCACCAAAACCAAACTGAAGCCAGTCAGCTTACTCATAATGTTGTTTCGGGGTTTACCATATTTTTACTGGTATTGGACAAAATACATTGGCCATTTGTTTATTGCTTGATAAGAATACATAGTTGATAAACCTGGATATTTAATTCAGAATCTGTCCTACCAAACTCTGATTTAAATCATTATCATTGAAACTTTTGTGTGAGACTTTGAAAGGGGTACTTTCTAAATGGCGATCTTAAAAGTATTCTAAAAGATAAAGGAAATTATTTGTCTTTGCCAG

Divergent primers for circular RNA PCR

Primer Set-1

Forward primer
Tm
Reverse primer
Tm
Product size

TGTGTGAGACTTTGAAAGGGGT

59.76

CTGCTAAGCCCCTAGGAAGC

59.89

168

Primer Set-2

Forward primer
Tm
Reverse primer
Tm
Product size

TGTGTGAGACTTTGAAAGGGGT

59.76

TGCTAAGCCCCTAGGAAGCT

60.33

167

PCR template sequence:

TATCATTGAAACTTTTGTGTGAGACTTTGAAAGGGGTACTTTCTAAATGGCGATCTTAAAAGTATTCTAAAAGATAAAGGAAATTATTTGTCTTTGCCAGGTAAGTGGCTCTGTCGGCATCCAAGAGTAGAAAGCAGCTGTAGAAGAGCAGATGGGTTTGGAAGCTTCCTAGGGGCTTAGCAGATACTGTGATAGTTAAT

Note: Users can design additional primers for provided template sequence using Primer3 or NCBI primer-blast.
miRNAs associated with circular RNAs
No of miRNAs

14

Interacting miRNAs (#binding sites)

mmu-miR-124-3p(1), mmu-miR-200a-3p(1), mmu-miR-27b-3p(1), mmu-miR-27a-3p(1), mmu-miR-298-5p(1), mmu-miR-101b-3p(1), mmu-miR-709(1), mmu-miR-22-3p(1), mmu-miR-411-3p(1), mmu-miR-342-3p(1), mmu-miR-377-3p(1), mmu-miR-207(1), mmu-miR-369-3p(1), mmu-miR-532-5p(1)

siRNAs for circular RNA silencing
Junction sequence

TTGTCTTTGCCAGGTAAGTGGCTCTG

siRNA sets

NA

Protein-coding potential of circular RNAs

CPAT analysis

CPAT ORF ID
CPAT Fickett
CPAT Hexamer
Coding probabilty
ORF length

NA

NA

NA

NA

NA

ORF sequence:

NA

Peptide sequence:

NA

IRESfinder result

IRESfinder score

0.880444004

IRES/non IRES

IRES

riboCIRC information

riboCIRC ID

NA

NA

Evidence
Peptide sequence:

NA

bottom of page